TMEM91 (NM_001098822) Human Untagged Clone

CAT#: SC316470

TMEM91 (untagged)-Human transmembrane protein 91 (TMEM91), transcript variant 3


  "NM_001098822" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TMEM91"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM91
Synonyms DSPC3; IFITMD6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001098822, the custom clone sequence may differ by one or more nucleotides
ATGGACAGCCCTAGTCTTCGTGAGCTTCAACAGCCTCTGCTGGAGGGCACAGAATGTGAG
ACCCCTGCCCAGAAGCCTGGCAGGCATGAGCTGGGGTCCCCCTTAAGAGAGATAGCCTTT
GCCGAGTCCCTGAGGGGTTTGCAGTTCCTGTCACCGCCTCTTCCCTCCGTGAGCGCTGGC
CTGGGGGAACCAAGGCCCCCTGATGTTGAGGACATGTCATCCAGTGACAGTGACTCGGAC
TGGGATGGAGGCAGCCGTCTTTCACCATTTCTACCCCACGACCACCTCGGCTTGGCTGTC
TTCTCCATGCTGTGTTGTTTCTGGCCCGTTGGCATCGCTGCCTTCTGTCTAGCCCAGAAG
ACCCGCCCTAGTTGCCCCTACAGCCCTCACTGTGAACCC
Restriction Sites Please inquire     
ACCN NM_001098822
ORF Size 402 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001098822.1, NP_001092292.1
RefSeq Size 943
RefSeq ORF 402
Locus ID 641649
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.