TMEM100 (NM_001099640) Human Untagged Clone

CAT#: SC316652

TMEM100 (untagged)-Human transmembrane protein 100 (TMEM100), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM100
• Synonyms: FLJ10970; FLJ37856
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001099640, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTGAAGAGCCCATCAAGGAGATCCTGGGAGCCCCAAAGGCTCACATGGCAGCGACGATGGAGAAGA
  GCCCCAAGAGTGAAGTTGTGATCACCACAGTCCCTCTGGTCAGTGAGATTCAGTTGATGGCTGCTACAGG
  GGGTACCGAGCTCTCCTGCTACCGCTGCATCATCCCCTTTGCTGTGGTTGTCTTCATCGCCGGCATCGTG
  GTCACCGCGGTGGCTTACAGCTTCAATTCCCATGGGTCTATTATCTCCATCTTTGGCCTGGTTGTTCTGT
  CATCTGGACTTTTTTTACTAGCCTCCAGTGCCTTGTGCTGGAAAGTGAGACAAAGGAGCAAGAAAGCCAA
  GAGACGGGAGAGTCAAACAGCTCTCGTGGCAAATCAGAGAAGCTTGTTTGCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001099640
• ORF Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001099640.1, NP_001093110.1
• RefSeq Size: 2269
• RefSeq ORF: 405
• Locus ID: 55273
• Protein Families: Transmembrane
• Gene Summary: Plays a role during embryonic arterial endothelium differentiation and vascular morphogenesis through the ACVRL1 receptor-dependent signaling pathway upon stimulation by bone morphogenetic proteins, such as GDF2/BMP9 and BMP10. Involved in the regulation of nociception, acting as a modulator of the interaction between TRPA1 and TRPV1, two molecular sensors and mediators of pain signals in dorsal root ganglia (DRG) neurons. Mechanistically, it weakens their interaction, thereby releasing the inhibition of TRPA1 by TRPV1 and increasing the single-channel open probability of the TRPA1-TRPV1 complex. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.