GLRA4 (NM_001024452) Human Untagged Clone
CAT#: SC317080
GLRA4 (untagged)-Human glycine receptor, alpha 4 (GLRA4), transcript variant 1
"NM_001024452" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GLRA4 |
Synonyms | glycine receptor, alpha 4; glycine receptor, alpha 4 subunit; OTTHUMP00000023760 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001024452, the custom clone sequence may differ by one or more nucleotides
ATGACAACTCTTGTTCCTGCAACCCTCTCCTTCCTTCTTCTCTGGACCCTGCCAGGGCAGGTCCTCCTCA GGGTGGCCTTGGCAAAAGAGGAAGTCAAATCTGGAACCAAGGGGTCCCAGCCCATGTCCCCCTCTGATTT CCTAGACAAACTTATGGGGCGAACATCTGGATATGATGCCAGGATTCGGCCCAATTTTAAAGGCCCACCC GTGAACGTGACCTGCAACATCTTCATCAACAGTTTCAGCTCCATCACCAAGACCACAATGGACTACCGGG TGAATGTCTTCTTGCGGCAACAGTGGAATGACCCACGCCTGTCCTACCGAGAATATCCTGATGACTCTCT GGACCTCGATCCCTCCATGCTGGACTCTATCTGGAAGCCAGACCTCTTCTTTGCTAATGAGAAAGGGGCC AACTTCCATGAGGTGACCACGGACAACAAGTTACTGCGCATCTTCAAGAATGGGAATGTGCTGTACAGCA TCAGGCTGACCCTCATTTTGTCCTGCCTGATGGACCTCAAGAACTTCCCCATGGACATCCAGACCTGCAC GATGCAGCTTGAGAGCTTTGGCTACACCATGAAAGACCTCGTGTTTGAGTGGCTGGAAGATGCTCCTGCT GTCCAAGTGGCTGAGGGGCTGACTCTGCCCCAGTTTATCTTGCGGGATGAGAAGGATCTAGGCTGTTGTA CCAAGCACTACAACACAGGGAAATTCACCTGCATCGAGGTAAAGTTTCACCTGGAACGGCAGATGGGCTA CTATCTGATTCAGATGTACATCCCCAGCCTACTCATCGTCATCCTGTCCTGGGTCTCCTTCTGGATCAAC ATGGATGCTGCCCCTGCCCGTGTGGGCCTGGGCATCACCACCGTGCTCACCATGACCACCCAGAGCTCTG GCTCCCGGGCCTCTTTGCCTAAGGTGTCCTACGTGAAGGCAATCGACATCTGGATGGCTGTGTGTCTGCT CTTTGTGTTCGCTGCCTTGCTGGAGTATGCTGCCATAAATTTTGTTTCTCGTCAGCATAAAGAATTCATA CGACTTCGAAGAAGGCAGAGGCGCCAACGCTTGGAGGAAGATATCATCCAAGAAAGTCGTTTCTATTTCC GTGGCTATGGCTTGGGCCACTGCCTGCAGGCAAGAGATGGAGGTCCAATGGAAGGTTCTGGCATTTATAG TCCCCAACCTCCAGCCCCTCTTCTAAGGGAAGGAGAAACCACGCGGAAACTCTACGTGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024452 |
ORF Size | 1254 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001024452.2, NP_001019623.2 |
RefSeq Size | 1675 |
RefSeq ORF | 1254 |
Locus ID | 441509 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein which has a neurotransmitter-gated ion-channel ligand binding domain. The encoded protein is very similar to a mouse protein which is a subunit of the retinal glycine receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC327841 | GLRA4 (untagged)-Human glycine receptor alpha 4 (GLRA4) |
USD 710.00 |
|
RC229206 | GLRA4 (Myc-DDK-tagged)-Human glycine receptor, alpha 4 (GLRA4), transcript variant 1 |
USD 420.00 |
|
RG229206 | GLRA4 (GFP-tagged) - Human glycine receptor, alpha 4 (GLRA4), transcript variant 1 |
USD 460.00 |
|
RC229206L3 | Lenti ORF clone of Human glycine receptor, alpha 4 (GLRA4), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC229206L4 | Lenti ORF clone of Human glycine receptor, alpha 4 (GLRA4), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review