DEFB136 (NM_001033018) Human Untagged Clone

CAT#: SC317219

DEFB136 (untagged)-Human defensin, beta 136 (DEFB136)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB136
• Synonyms: DEFB137
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001033018, the custom clone sequence may differ by one or more nucleotides
  ATGAACCTCTGTCTTTCTGCATTACTCTTTTTCCTGGTGATCTTACTGCCTTCAGGAAAA
  GGTATGTTTGGGAATGATGGAGTCAAAGTTCGCACCTGCACTAGCCAGAAAGCCGTATGT
  TTCTTCGGGTGTCCGCCAGGATACAGGTGGATTGCGTTCTGCCACAATATTCTGTCTTGC
  TGTAAAAATATGACACGTTTTCAACCCCCGCAAGCCAAAGATCCATGGGTTCAT
  
• Restriction Sites: Please inquire
• ACCN: NM_001033018
• ORF Size: 237 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001033018.2, NP_001028190.2
• RefSeq Size: 237
• RefSeq ORF: 237
• Locus ID: 613210
• Gene Summary: Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The antimicrobial protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 8p23. [provided by RefSeq, Nov 2014]