HEF1 (NEDD9) (NM_182966) Human Untagged Clone

CAT#: SC317272

NEDD9 (untagged)-Human neural precursor cell expressed, developmentally down-regulated 9 (NEDD9), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NEDD9
• Synonyms: CAS-L; CAS2; CASL; CASS2; HEF1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_182966, the custom clone sequence may differ by one or more nucleotides
  ATGAAGTATAAGAATCTTATGGCAAGGGCCTTATATGACAATGTCCCAGAGTGTGCCGAG
  GAACTGGCCTTTCGCAAGGGAGACATCCTGACCGTCATAGAGCAGAACACAGGGGGACTG
  GAAGGATGGTGGCTGTGCTCGTTACACGGTCGGCAAGGCATTGTCCCAGGCAACCGGGTG
  AAGCTTCTGATTGGTCCCATGCAGGAGACTGCCTCCAGTCACGAGCAGCCTGCCTCTGGA
  CTGATGCAGCAGACCTTTGGCCAACAGAAGCTCTATCAAGTGCCAAACCCACAGGCTGCT
  CCCCGAGACACCATCTACCAAGTGCCACCTTCCTACCAAAATCAGGGAATTTACCAAGTC
  CCCACTGGCCACGGCACCCAAGAACAAGAGGTATATCAGGTGCCACCATCAGTGCAGAGA
  AGCATTGGGGGAACCAGTGGGCCCCACGTGGGTAAAAAGGTGTTCCAGAGAGATGGGCAA
  GTGTCCTATTTCTTAGTGAGAGCCTCTAAACAAACCAGCTTG
  
• Restriction Sites: Please inquire
• ACCN: NM_182966
• Insert Size: 1329 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_182966.2, NP_892011.2
• RefSeq Size: 1329 bp
• RefSeq ORF: 1329 bp
• Locus ID: 4739
• Cytogenetics: 6p24.2
• Gene Summary: 'The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]'
  Transcript Variant: This variant (2) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1.