RWDD3 (NM_015485) Human Untagged Clone

CAT#: SC317385

RWDD3 (untagged)-Human RWD domain containing 3 (RWDD3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RWDD3
• Synonyms: RSUME
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_015485, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGAGCCTGTGCAGGAGGAGCTCTCGGTCCTGGCCGCGATTTTCTGCAGGCCCCACGAGTGGGAGG
  TGCTGAGCCGCTCAGAGACAGATGGGACCGTGTTCAGAATTCACACAAAAGCTGAAGGATTTATGGATGC
  GGATATACCTCTGGAATTGGTGTTCCATTTGCCAGTCAATTATCCTTCATGTCTACCTGGTATCTCGATT
  AACTCTGAACAGTTGACCAGGGCCCAGTGTGTGACTGTGAAAGAGAATTTACTTGAGCAAGCAGAGAGCC
  TTTTGTCGGAGCCTATGGTTCATGAGCTGGTTCTCTGGATTCAGCAGAATCTCAGGCATATCCTCAGCCA
  ACCAGAAACTGGCAGTGGCAGTGAAAAGTGTACTTTTTCAACAAGCACGACCATGGATGATGGATTGTGG
  ATAACTCTTTTGCATTTAGATCACATGAGAGCAAAGACTAAATATGTCAAAATTGTGGAGAAGTGGGCTT
  CAGATTTAAGGCTGACAGGAAGACTGATGTTCATGGGTAAAATAATACTGATTTTACTACAGGGAGACAG
  AAACAACCTCAAGGAGTACTTGATTCTTCAGAAAACCTCCAAAGTAGATGTGGACTCAAGTGGAAAGAAA
  TGCAAAGAGAAAATGATTAGTGTACTGTTTGAAACAAAAGTACAGACAGAACACAAAAGGTTTCTGGCAT
  TTGAAGTCAAAGAGTATTCAGCGTTGGATGAATTACAAAAGGAATTTGAAACTGCAGGACTTAAGAAGCT
  TTTCTCCGAATTTGTACTTGCTCTGGTAAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_015485
• ORF Size: 804 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_015485.4, NP_056300.2
• RefSeq Size: 1250
• RefSeq ORF: 804
• Locus ID: 25950
• Domains: RWD
• Gene Summary: Enhancer of SUMO conjugation. Via its interaction with UBE2I/UBC9, increases SUMO conjugation to proteins by promoting the binding of E1 and E2 enzymes, thioester linkage between SUMO and UBE2I/UBC9 and transfer of SUMO to specific target proteins which include HIF1A, PIAS, NFKBIA, NR3C1 and TOP1. Isoform 1 and isoform 2 positively regulate the NF-kappa-B signaling pathway by enhancing the sumoylation of NF-kappa-B inhibitor alpha (NFKBIA), promoting its stabilization which consequently leads to an increased inhibition of NF-kappa-B transcriptional activity. Isoform 1 and isoform 2 negatively regulate the hypoxia-inducible factor-1 alpha (HIF1A) signaling pathway by increasing the sumoylation of HIF1A, promoting its stabilization, transcriptional activity and the expression of its target gene VEGFA during hypoxia. Isoform 2 promotes the sumoylation and transcriptional activity of the glucocorticoid receptor NR3C1 and enhances the interaction of SUMO1 and NR3C1 with UBE2I/UBC9. Has no effect on ubiquitination. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longest isoform (a).