KCTD17 (NM_024681) Human Untagged Clone

CAT#: SC317438

KCTD17 (untagged)-Human potassium channel tetramerisation domain containing 17 (KCTD17)


  "NM_024681" in other vectors (5)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCTD17"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCTD17
Synonyms FLJ12242; FLJ98761
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_024681, the custom clone sequence may differ by one or more nucleotides


ATGCAGACGCCGCGGCCGGCGATGAGGATGGAGGCCGGGGAGGCAGCGCCGCCGGCGGGGGCGGGCGGCC
GCGCCGCAGGCGGCTGGGGCAAGTGGGTGCGGCTCAACGTGGGGGGCACGGTGTTCCTGACCACCCGGCA
GACGCTGTGCCGCGAGCAGAAGTCCTTCCTCAGCCGCCTGTGCCAGGGGGAAGAGCTGCAGTCGGACCGG
GATGAGACCGGGGCCTACCTCATTGACCGTGACCCCACCTACTTCGGGCCCATCCTGAACTTCCTCCGGC
ATGGCAAGCTGGTGCTGGACAAGGACATGGCTGAGGAGGGGGTCCTGGAGGAAGCCGAGTTCTACAACAT
CGGCCCGCTGATCCGCATCATCAAAGACCGGATGGAAGAGAAGGACTACACGGTCACCCAGGTCCCACCC
AAGCACGTGTACCGCGTGCTGCAGTGCCAGGAGGAGGAGCTCACGCAAATGGTCTCCACCATGTCTGATG
GCTGGCGCTTCGAGCAGCTGGTGAACATCGGCTCCTCCTACAACTACGGCAGCGAGGACCAGGCAGAGTT
CCTGTGTGTGGTGTCCAAGGAGCTCCACAGCACCCCAAACGGGCTGAGCTCAGAGTCCAGCCGCAAAACC
AAGAGCACGGAGGAGCAGCTGGAGGAGCAGCAGCAGCAGGAGGAGGAGGTGGAGGAGGTGGAGGTGGAAC
AGGTGCAGGTGGAGGCAGATGCACAGGAGAAAGGTTCCCGTCCGCACCCTCTCAGACCTGAGGCTGAGCT
TGCAGTGAGGGCTTCTCCTCGGCCCCTCGCCCGCCCCCAGAGCTGCCATCCCTGCTGTTACAAGCCAGAG
GCACCCGGATGTGAGGCCCCAGATCACCTCCAGGGACTTGGGGTTCCCATCTGA


Restriction Sites SgfI-MluI     
ACCN NM_024681
ORF Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_024681.3, NP_078957.2
RefSeq Size 1707
RefSeq ORF 894
Locus ID 79734
Protein Families Ion Channels: Other
Gene Summary This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.