KCTD17 (NM_024681) Human Untagged Clone
CAT#: SC317438
KCTD17 (untagged)-Human potassium channel tetramerisation domain containing 17 (KCTD17)
"NM_024681" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCTD17 |
Synonyms | FLJ12242; FLJ98761 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_024681, the custom clone sequence may differ by one or more nucleotides
ATGCAGACGCCGCGGCCGGCGATGAGGATGGAGGCCGGGGAGGCAGCGCCGCCGGCGGGGGCGGGCGGCC GCGCCGCAGGCGGCTGGGGCAAGTGGGTGCGGCTCAACGTGGGGGGCACGGTGTTCCTGACCACCCGGCA GACGCTGTGCCGCGAGCAGAAGTCCTTCCTCAGCCGCCTGTGCCAGGGGGAAGAGCTGCAGTCGGACCGG GATGAGACCGGGGCCTACCTCATTGACCGTGACCCCACCTACTTCGGGCCCATCCTGAACTTCCTCCGGC ATGGCAAGCTGGTGCTGGACAAGGACATGGCTGAGGAGGGGGTCCTGGAGGAAGCCGAGTTCTACAACAT CGGCCCGCTGATCCGCATCATCAAAGACCGGATGGAAGAGAAGGACTACACGGTCACCCAGGTCCCACCC AAGCACGTGTACCGCGTGCTGCAGTGCCAGGAGGAGGAGCTCACGCAAATGGTCTCCACCATGTCTGATG GCTGGCGCTTCGAGCAGCTGGTGAACATCGGCTCCTCCTACAACTACGGCAGCGAGGACCAGGCAGAGTT CCTGTGTGTGGTGTCCAAGGAGCTCCACAGCACCCCAAACGGGCTGAGCTCAGAGTCCAGCCGCAAAACC AAGAGCACGGAGGAGCAGCTGGAGGAGCAGCAGCAGCAGGAGGAGGAGGTGGAGGAGGTGGAGGTGGAAC AGGTGCAGGTGGAGGCAGATGCACAGGAGAAAGGTTCCCGTCCGCACCCTCTCAGACCTGAGGCTGAGCT TGCAGTGAGGGCTTCTCCTCGGCCCCTCGCCCGCCCCCAGAGCTGCCATCCCTGCTGTTACAAGCCAGAG GCACCCGGATGTGAGGCCCCAGATCACCTCCAGGGACTTGGGGTTCCCATCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_024681 |
ORF Size | 894 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_024681.3, NP_078957.2 |
RefSeq Size | 1707 |
RefSeq ORF | 894 |
Locus ID | 79734 |
Protein Families | Ion Channels: Other |
Gene Summary | This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC122966 | KCTD17 (untagged)-Human potassium channel tetramerisation domain containing 17 (KCTD17) |
USD 660.00 |
|
RC206070 | KCTD17 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 17 (KCTD17) |
USD 420.00 |
|
RG206070 | KCTD17 (GFP-tagged) - Human potassium channel tetramerisation domain containing 17 (KCTD17) |
USD 460.00 |
|
RC206070L3 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 17 (KCTD17), Myc-DDK-tagged |
USD 620.00 |
|
RC206070L4 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 17 (KCTD17), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review