CXXC5 (NM_016463) Human Untagged Clone
CAT#: SC317489
CXXC5 (untagged)-Human CXXC finger protein 5 (CXXC5)
"NM_016463" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CXXC5 |
Synonyms | CF5; HSPC195; RINF; WID |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_016463, the custom clone sequence may differ by one or more nucleotides
ATGTCGAGCCTCGGCGGTGGCTCCCAGGATGCCGGCGGCAGTAGCAGCAGCAGCACCAATGGCAGCGGTG GCAGTGGCAGCAGTGGCCCAAAGGCAGGAGCAGCAGACAAGAGTGCAGTGGTGGCTGCCGCCGCACCAGC CTCAGTGGCAGATGACACACCACCCCCCGAGCGTCGGAACAAGAGCGGTATCATCAGTGAGCCCCTCAAC AAGAGCCTGCGCCGCTCCCGCCCGCTCTCCCACTACTCTTCTTTTGGCAGCAGTGGTGGTAGTGGCGGTG GCAGCATGATGGGCGGAGAGTCTGCTGACAAGGCCACTGCGGCTGCAGCCGCTGCCTCCCTGTTGGCCAA TGGGCATGACCTGGCGGCGGCCATGGCGGTGGACAAAAGCAACCCTACCTCAAAGCACAAAAGTGGTGCT GTGGCCAGCCTGCTGAGCAAGGCAGAGCGGGCCACGGAGCTGGCAGCCGAGGGACAGCTGACGCTGCAGC AGTTTGCGCAGTCCACAGAGATGCTGAAGCGCGTGGTGCAGGAGCATCTCCCGCTGATGAGCGAGGCGGG TGCTGGCCTGCCTGACATGGAGGCTGTGGCAGGTGCCGAAGCCCTCAATGGCCAGTCCGACTTCCCCTAC CTGGGCGCTTTCCCCATCAACCCAGGCCTCTTCATTATGACCCCGGCAGGTGTGTTCCTGGCCGAGAGCG CGCTGCACATGGCGGGCCTGGCTGAGTACCCCATGCAGGGAGAGCTGGCCTCTGCCATCAGCTCCGGCAA GAAGAAGCGGAAACGCTGCGGCATGTGCGCGCCCTGCCGGCGGCGCATCAACTGCGAGCAGTGCAGCAGT TGTAGGAATCGAAAGACTGGCCATCAGATTTGCAAATTCAGAAAATGTGAGGAACTCAAAAAGAAGCCTT CCGCTGCTCTGGAGAAGGTGATGCTTCCGACGGGAGCCGCCTTCCGGTGGTTTCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_016463 |
ORF Size | 969 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_016463.8, NP_057547.5 |
RefSeq Size | 2682 |
RefSeq ORF | 969 |
Locus ID | 51523 |
Domains | zf-CXXC |
Gene Summary | The protein encoded by this gene is a retinoid-inducible nuclear protein containing a CXXC-type zinc finger motif. The encoded protein is involved in myelopoiesis, is required for DNA damage-induced p53 activation, regulates the differentiation of C2C12 myoblasts into myocytes, and negatively regulates cutaneous wound healing. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All of the variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC319180 | CXXC5 (untagged)-Human CXXC finger protein 5 (CXXC5) |
USD 660.00 |
|
RC202963 | CXXC5 (Myc-DDK-tagged)-Human CXXC finger protein 5 (CXXC5) |
USD 420.00 |
|
RG202963 | CXXC5 (GFP-tagged) - Human CXXC finger protein 5 (CXXC5) |
USD 460.00 |
|
RC202963L1 | Lenti ORF clone of Human CXXC finger protein 5 (CXXC5), Myc-DDK-tagged |
USD 768.00 |
|
RC202963L2 | Lenti ORF clone of Human CXXC finger protein 5 (CXXC5), mGFP tagged |
USD 620.00 |
|
RC202963L3 | Lenti ORF clone of Human CXXC finger protein 5 (CXXC5), Myc-DDK-tagged |
USD 620.00 |
|
RC202963L4 | Lenti ORF clone of Human CXXC finger protein 5 (CXXC5), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review