CXXC5 (NM_016463) Human Untagged Clone

CAT#: SC317489

CXXC5 (untagged)-Human CXXC finger protein 5 (CXXC5)


  "NM_016463" in other vectors (7)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CXXC5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CXXC5
Synonyms CF5; HSPC195; RINF; WID
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016463, the custom clone sequence may differ by one or more nucleotides


ATGTCGAGCCTCGGCGGTGGCTCCCAGGATGCCGGCGGCAGTAGCAGCAGCAGCACCAATGGCAGCGGTG
GCAGTGGCAGCAGTGGCCCAAAGGCAGGAGCAGCAGACAAGAGTGCAGTGGTGGCTGCCGCCGCACCAGC
CTCAGTGGCAGATGACACACCACCCCCCGAGCGTCGGAACAAGAGCGGTATCATCAGTGAGCCCCTCAAC
AAGAGCCTGCGCCGCTCCCGCCCGCTCTCCCACTACTCTTCTTTTGGCAGCAGTGGTGGTAGTGGCGGTG
GCAGCATGATGGGCGGAGAGTCTGCTGACAAGGCCACTGCGGCTGCAGCCGCTGCCTCCCTGTTGGCCAA
TGGGCATGACCTGGCGGCGGCCATGGCGGTGGACAAAAGCAACCCTACCTCAAAGCACAAAAGTGGTGCT
GTGGCCAGCCTGCTGAGCAAGGCAGAGCGGGCCACGGAGCTGGCAGCCGAGGGACAGCTGACGCTGCAGC
AGTTTGCGCAGTCCACAGAGATGCTGAAGCGCGTGGTGCAGGAGCATCTCCCGCTGATGAGCGAGGCGGG
TGCTGGCCTGCCTGACATGGAGGCTGTGGCAGGTGCCGAAGCCCTCAATGGCCAGTCCGACTTCCCCTAC
CTGGGCGCTTTCCCCATCAACCCAGGCCTCTTCATTATGACCCCGGCAGGTGTGTTCCTGGCCGAGAGCG
CGCTGCACATGGCGGGCCTGGCTGAGTACCCCATGCAGGGAGAGCTGGCCTCTGCCATCAGCTCCGGCAA
GAAGAAGCGGAAACGCTGCGGCATGTGCGCGCCCTGCCGGCGGCGCATCAACTGCGAGCAGTGCAGCAGT
TGTAGGAATCGAAAGACTGGCCATCAGATTTGCAAATTCAGAAAATGTGAGGAACTCAAAAAGAAGCCTT
CCGCTGCTCTGGAGAAGGTGATGCTTCCGACGGGAGCCGCCTTCCGGTGGTTTCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_016463
ORF Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_016463.8, NP_057547.5
RefSeq Size 2682
RefSeq ORF 969
Locus ID 51523
Domains zf-CXXC
Gene Summary The protein encoded by this gene is a retinoid-inducible nuclear protein containing a CXXC-type zinc finger motif. The encoded protein is involved in myelopoiesis, is required for DNA damage-induced p53 activation, regulates the differentiation of C2C12 myoblasts into myocytes, and negatively regulates cutaneous wound healing. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All of the variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.