DPP1 (CTSC) (NM_001114173) Human Untagged Clone

CAT#: SC318774

CTSC (untagged)-Human cathepsin C (CTSC), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTSC
• Synonyms: CPPI; DPP-I; DPP1; DPPI; HMS; JP; JPD; PALS; PDON1; PLS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001114173, the custom clone sequence may differ by one or more nucleotides
  ATGGGTGCTGGGCCCTCCTTGCTGCTCGCCGCCCTCCTGCTGCTTCTCTCCGGCGACGGC
  GCCGTGCGCTGCGACACACCTGCCAACTGCACCTATCTTGACCTGCTGGGCACCTGGGTC
  TTCCAGGTGGGCTCCAGCGGTTCCCAGCGCGATGTCAACTGCTCGGTTATGGGACCACAA
  GAAAAAAAAGTAGTGGTGTACCTTCAGAAGCTGGATACAGCATATGATGACCTTGGCAAT
  TCTGGCCATTTCACCATCATTTACAACCAAGGCTTTGAGATTGTGTTGAATGACTACAAG
  TGGTTTGCCTTTTTTAAGGATGTCACTGATTTTATCAGTCATTTGTTCATGCAGCTGGGA
  ACTGTGGGGATATATGATTTGCCACATCTGAGGAACAAACTGGCCATGAACAGACGTTGG
  GGC
  
• Restriction Sites: Please inquire
• ACCN: NM_001114173
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001114173.1, NP_001107645.1
• RefSeq Size: 6099 bp
• RefSeq ORF: 426 bp
• Locus ID: 1075
• Cytogenetics: 11q14.2
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Lysosome
• Gene Summary: 'This gene encodes a member of the peptidase C1 family and lysosomal cysteine proteinase that appears to be a central coordinator for activation of many serine proteinases in cells of the immune system. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate heavy and light chains that form a disulfide-linked dimer. A portion of the propeptide acts as an intramolecular chaperone for the folding and stabilization of the mature enzyme. This enzyme requires chloride ions for activity and can degrade glucagon. Defects in the encoded protein have been shown to be a cause of Papillon-Lefevre syndrome, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. [provided by RefSeq, Nov 2015]'
  Transcript Variant: This variant (3) differs in the coding sequence and 3' UTR compared to variant 1. This results in an isoform (c) that is much shorter and contains a different C-terminus than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.