TMEM240 (NM_001114748) Human Untagged Clone

CAT#: SC318788

TMEM240 (untagged)-Human chromosome 1 open reading frame 70 (C1orf70)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM240
• Synonyms: C1orf70; SCA21
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001114748, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCATGAGCGCGAACACCATGATCTTCATGATTCTGGGGGCGTCGGTCGTGATGGCCATCGCGTGCT
  TGATGGACATGAACGCGCTGCTGGACCGATTCCACAACTACATCCTCCCGCACCTGCGGGGCGAGGACCG
  CGTCTGCCACTGCAACTGTGGCCGGCACCATATCCACTACGTGATCCCGTACGACGGGGACCAGTCGGTG
  GTGGACGCCTCCGAGAACTACTTTGTGACGGACAGTGTGACCAAGCAGGAGATCGACCTCATGCTGGGGC
  TGCTGCTGGGCTTTTGCATCAGCTGGTTCCTGGTGTGGATGGACGGCGTCCTGCACTGCGCCGTGCGCGC
  CTGGAGAGCCGGACGGCGCTACGATGGCTCGTGGACCTGGCTGCCCAAGCTGTGCAGCCTGCGGGAGCTG
  GGCCGGCGGCCGCACAGGCCCTTCGAGGAGGCCGCCGGGAACATGGTACACGTGAAGCAGAAACTCTACC
  ACAATGGCCACCCCAGCCCGCGGCACCTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001114748
• ORF Size: 522 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001114748.1, NP_001108220.1
• RefSeq Size: 1128
• RefSeq ORF: 522
• Locus ID: 339453
• Gene Summary: This gene encodes a transmembrane-domain containing protein found in the brain and cerebellum. Mutations in this gene result in spinocerebellar ataxia 21. [provided by RefSeq, Dec 2014]