PMP70 (ABCD3) (NM_001122674) Human Untagged Clone

CAT#: SC318802

ABCD3 (untagged)-Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABCD3
• Synonyms: ABC43; CBAS5; PMP70; PXMP1; ZWS2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001122674, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCCTTCAGCAAGTACTTGACGGCGCGAAACTCCTCGCTGGCTGGTGCCGCGTTCCTGCTGCTCT
  GCCTGCTCCACAAGCGGCGCCGCGCCCTCGGCCTGCACGGTAAGAAAAGTGGAAAACCACCATTACAGAA
  CAATGAGAAAGAGGGGAAAAAGGAGCGAGCTGTGGTGGACAAGGTGTTTTTCTCAAGGCTCATACAGATT
  CTGAAAATCATGGTCCCTAGAACATTTTGTAAAGAGACAGGTTACTTGGTACTTATTGCTGTTATGCTGG
  TGTCTCGAACATATTGTGATGTTTGGATGATTCAAAATGGGACACTAATTGAAAGTGGTATCATTGGTCG
  TAGCAGGAAAGATTTCAAGAGATACTTACTCAACTTCATCGCTGCCATGCCTCTTATCTCTCTGGTTAAT
  AACTTCTTGAAGTATGGGTTAAATGAGCTTAAACTGTGCTTCCGAGTAAGGCTCACTAAATACCTCTATG
  AGGAGTATCTTCAAGCTTTCACATATTATAAAATGGGGAATCTGGACAACAGAATAGCTAATCCAGACCA
  GCTGCTTACACAAGATGTAGAAAAATTTTGTAACAGTGTAGTCGATCTGTATTCAAATCTTAGTAAGCCA
  TTTTTAGACATAGTTTTGTATATCTTTAAGTTAACGAGTGCAATTGGAGCTCAGGTACTTGGAAAAATTT
  TGTGGCATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001122674
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001122674.1, NP_001116146.1
• RefSeq Size: 967 bp
• RefSeq ORF: 711 bp
• Locus ID: 5825
• Cytogenetics: 1p21.3
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ABC transporters
• Gene Summary: 'The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) has multiple differences in the 3' coding region and 3' UTR and contains an alternate exon in the central coding region, compared to variant 1, that results in a protein (isoform b) with a shorter, distinct C-terminus when compared to isoform a.