CCBL1 (KYAT1) (NM_001122672) Human Untagged Clone

CAT#: SC318844

CCBL1 (untagged)-Human cysteine conjugate-beta lyase, cytoplasmic (CCBL1), transcript variant 3


  "NM_001122672" in other vectors (4)

Reconstitution Protocol

USD 760.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KYAT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KYAT1
Synonyms CCBL1; GTK; KAT1; KATI
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001122672, the custom clone sequence may differ by one or more nucleotides
ATGGCCAAACAGCTGCAGGCCCGAAGGCTAGACGGGATCGACTACAACCCCTGGGTGGAG
TTTGTGAAACTGGCCAGTGAGCATGACGTCGTGAACTTGGGCCAGGGCTTCCCGGATTTC
CCACCACCAGACTTTGCCGTGGAAGCCTTTCAGCACGCTGTCAGTGGAGACTTCATGCTT
AACCAGTACACCAAGACATTTGTCATCATCATCGAACCCTTTTTTGACTGCTACGAGCCC
ATGACAATGATGGCAGGGGGTCGTCCTGTGTTTGTGTCCCTGAAGCCGGGTCCCATCCAG
AATGGAGAACTGGGTTCCAGCAGCAACTGGCAGCTGGACCCCATGGAGCTGGCCGGCAAA
TTCACATCACGCACCAAAGCCCTGGTCCTCAACACCCCCAACAACCCCCTGGGCAAGGTG
TTCTCCAGGGAAGAGCTGGAGCTGGTGGCCAGCCTTTGCCAGCAGCATGACGTGGTGTGT
ATCACTGATGAAGTCTACCAGTGGATGGTCTACGACGGGCACCAGCACATCAGCATTGCC
AGCCTCCCTGGCATGTGGGAACGGACCCTGACCATCGGCAGCGCCGGCAAGACCTTCAGC
GCCACTGGCTGGAAGGTGGGCTGGGTCCTGGGTCCAGATCACATCATGAAGCACCTGCGG
ACCGTGCACCAGAACTCCGTCTTCCACTGCCCCACGCAGAGCCAGGCTGCAGTAGCCGAG
AGCTTTGAACGGGAGCAGCTGCTCTTCCGCCAACCCAGCAGCTACTTTGTGCAGTTCCCG
CAGGCCATGCAGCGCTGCCGTGACCACATGATACGTAGCCTACAGTCAGTGGGCCTGAAG
CCCATCATCCCTCAGGGCAGCTACTTCCTCATCACAGACATCTCAGACTTCAAGAGGAAG
ATGCCTGACTTGCCTGGAGCTGTGGATGAGCCCTATGACAGACGCTTCGTCAAGTGGATG
ATCAAGAACAAGGGCTTGGTGGCCATCCCTGTCTCCATCTTCTATAGTGTGCCACATCAG
AAGCACTTTGACCACTATATCCGCTTCTGTTTTGTGAAGGATGAAGCCACGCTCCAGGCC
ATGGACGAGAAGCTGCGGAAGTGGAAGGTGGAACTC
Restriction Sites Please inquire     
ACCN NM_001122672
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001122672.1, NP_001116144.1
RefSeq Size 1792 bp
RefSeq ORF 1119 bp
Locus ID 883
Cytogenetics 9q34.11
Gene Summary 'This gene encodes a cytosolic enzyme that is responsible for the metabolism of cysteine conjugates of certain halogenated alkenes and alkanes. This metabolism can form reactive metabolites leading to nephrotoxicity and neurotoxicity. Increased levels of this enzyme have been linked to schizophrenia. Multiple transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the mid-coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.