TMEM126B (NM_018480) Human Untagged Clone

CAT#: SC321745

TMEM126B (untagged)-Human transmembrane protein 126B (TMEM126B), transcript variant 1


  "NM_018480" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TMEM126B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM126B
Synonyms HT007; MC1DN29
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_018480, the custom clone sequence may differ by one or more nucleotides


ATGGTGGTGTTCGGGTATGAGGCTGGGACTAAGCCAAGGGATTCAGGTGTGGTGCCGGTGGGAACTGAGG
AAGCGCCCAAGGTTTTCAAGATGGCAGCATCTATGCATGGTCAGCCCAGTCCTTCTCTAGAAGATGCAAA
ACTCAGAAGACCAATGGTCATAGAAATCATAGAAAAAAATTTTGACTATCTTAGAAAAGAAATGACACAA
AATATATATCAAATGGCGACATTTGGAACAACAGCTGGTTTCTCTGGAATATTCTCAAACTTCCTGTTCA
GACGCTGCTTCAAGGTTAAACATGATGCTTTGAAGACATATGCATCATTGGCTACACTTCCATTTTTGTC
TACTGTTGTTACTGACAAGCTTTTTGTAATTGATGCTTTGTATTCAGATAATATAAGCAAGGAAAACTGT
GTTTTCAGAAGCTCACTGATTGGCATAGTTTGTGGTGTTTTCTATCCCAGTTCTTTGGCTTTTACTAAAA
ATGGACGCCTGGCAACCAAGTATCATACCGTTCCACTGCCACCAAAAGGAAGGGTTTTAATCCATTGGAT
GACGCTTTGTCAAACACAAATGAAATTAATGGCGATTCCTCTAGTCTTTCAGATTATGTTTGGAATATTA
AATGGTCTATACCATTATGCAGTATTTGAAGAGACACTTGAGAAAACTATACATGAAGAGTAA


Restriction Sites RsrII-NotI     
ACCN NM_018480
ORF Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_018480.4, NP_060950.3
RefSeq Size 1038
RefSeq ORF 693
Locus ID 55863
Protein Families Transmembrane
Gene Summary This gene encodes a mitochondrial transmembrane protein which is a component of the mitochondrial complex I assembly complex. The encoded protein serves as an assembly factor that is required for formation of the membrane arm of the complex. It interacts with NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 13. Naturally occurring mutations in this gene are associated with isolated complex I deficiency. A pseudogene of this gene has been defined on chromosome 9. [provided by RefSeq, Apr 2017]
Transcript Variant: This variant (1) encodes the longest isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.