THTPA (NM_001126339) Human Untagged Clone

CAT#: SC322907

THTPA (untagged)-Human thiamine triphosphatase (THTPA), transcript variant 2


  "NM_001126339" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "THTPA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol THTPA
Synonyms THTP; THTPASE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001126339, the custom clone sequence may differ by one or more nucleotides


ATGGCCCAGGGCTTGATTGAGGTGGAGCGAAAGTTCCTTCCAGGGCCTGGCACAGAGGAGCGGCTGCAGG
AGTTGGGGGGCACCCTGGAGTACCGGGTCACCTTCCGAGACACCTACTATGACACCCCTGAGCTGAGCCT
CATGCAGGCTGACCACTGGCTGCGACGACGAGAGGATAGTGGATGGGAGCTCAAATGTCCTGGAGCAGCA
GGTGTCTTAGGACCCCACACGGAGTATAAGGAACTCACAGCGGAACCTACAATTGTGGCCCAACTCTGTA
AGGTGCTGCGGGCTGACGGCCTGGGGGCTGGAGATGTGGCTGCTGTGCTGGGCCCACTGGGGCTGCAGGA
AGTAGCTAGTTTTGTGACTAAGCGGAGTGCCTGGAAGCTGGTGCTCTTGGGAGCTGATGAAGAGGAGCCA
CAGCTCAGGGTGGACTTGGATACAGCCGACTTTGGCTACGCTGTGGGTGAGGTAGAGGCCCTGGTGCATG
AGGAGGCTGAAGTACCAACTGCCCTAGAGAAGATCCACAGGCTCAGCAGCATGCTTGGTGTGCCTGCACA
GGAGACAGCACCAGCCAAGCTGATTGTGTATCTACAGCGTTTCCGGCCTCAAGACTATCAGCGCCTGCTA
GAAGTGAACAGCTCCAGAGAGAGGCCACAGGAGACTGAAGATCCTGACCACTGCCTGGGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001126339
ORF Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001126339.3, NP_001119811.1
RefSeq Size 1829
RefSeq ORF 693
Locus ID 79178
Protein Pathways Metabolic pathways, Thiamine metabolism
Gene Summary This gene encodes an enzyme which catalyzes the biosynthesis of thiamine disphophate (vitamin B1) by hydrolysis of thiamine triphosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) lacks a segment of the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.