AUTS2 (NM_001127232) Human Untagged Clone

CAT#: SC322935

AUTS2 (untagged)-Human autism susceptibility candidate 2 (AUTS2), transcript variant 3


  "NM_001127232" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AUTS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AUTS2
Synonyms FBRSL2; MRD26
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001127232, the custom clone sequence may differ by one or more nucleotides


ATGGATGGCCCGACGCGGGGCCATGGACTCCGCAAAAAGCGGCGGTCGCGGTCGCAGCGAGACCGGGAGA
GGCGCTCCCGGGGCGGGCTGGGGGCCGGCGCGGCCGGCGGCGGCGGGGCTGGCCGGACCCGGGCGCTCTC
ACTCGCCTCGTCGTCGGGCTCCGACAAGGAAGACAATGGGAAGCCCCCGTCCTCCGCCCCGTCCCGGCCC
AGACCCCCGCGGAGGAAGCGGAGAGAGTCCACCTCGGCAGAAGAGGACATCATTGATGGATTTGCCATGA
CCAGCTTTGTCACTTTTGAAGCGCTGGAGAAAGATGTAGCACTTAAGCCTCAGGAACGTGTGGAGAAACG
CCAGACGCCCCTGACCAAGAAGAAACGAGAAGCACTTACCAATGGCTTGTCCTTTCATTCAAAGAAGAGC
AGACTCAGCCACCCACACCACTACAGCTCAGATCGAGAAAATGACCGCAATCTCTGCCAGCACCTTGGGA
AGAGAAAGAAAATGCCGAAGGCACTCAGACAGCTCAAGCCAGGACAGAACAGCTGCAGGGACAGTGACAG
TGAAAGTGCCAGTGGAGAATCCAAGGGCTTCCACCGGAGCAGCTCTCGGGAAAGGCTCAGTGATAGTTCA
GCTCCTTCCAGCTTGGGAACAGGCTACTTCAGATCAGGGAAGATGTGCCTTGGAGAGGAAGCATGTCTTA
AATCTGGAAATGATATGAAGAGGGATGTCAGCAACACTTCATCCTGGGCCAGTAATAGGGAGAGTTTCTT
TTCTCTCGTCAAATTGCTTAAAGGATTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001127232
ORF Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001127232.2, NP_001120704.1
RefSeq Size 1826
RefSeq ORF 801
Locus ID 26053
Gene Summary This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Transcript Variant: This variant (3) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. The encoded protein (isoform 3) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.