AUTS2 (NM_001127232) Human Untagged Clone
CAT#: SC322935
AUTS2 (untagged)-Human autism susceptibility candidate 2 (AUTS2), transcript variant 3
"NM_001127232" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AUTS2 |
Synonyms | FBRSL2; MRD26 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001127232, the custom clone sequence may differ by one or more nucleotides
ATGGATGGCCCGACGCGGGGCCATGGACTCCGCAAAAAGCGGCGGTCGCGGTCGCAGCGAGACCGGGAGA GGCGCTCCCGGGGCGGGCTGGGGGCCGGCGCGGCCGGCGGCGGCGGGGCTGGCCGGACCCGGGCGCTCTC ACTCGCCTCGTCGTCGGGCTCCGACAAGGAAGACAATGGGAAGCCCCCGTCCTCCGCCCCGTCCCGGCCC AGACCCCCGCGGAGGAAGCGGAGAGAGTCCACCTCGGCAGAAGAGGACATCATTGATGGATTTGCCATGA CCAGCTTTGTCACTTTTGAAGCGCTGGAGAAAGATGTAGCACTTAAGCCTCAGGAACGTGTGGAGAAACG CCAGACGCCCCTGACCAAGAAGAAACGAGAAGCACTTACCAATGGCTTGTCCTTTCATTCAAAGAAGAGC AGACTCAGCCACCCACACCACTACAGCTCAGATCGAGAAAATGACCGCAATCTCTGCCAGCACCTTGGGA AGAGAAAGAAAATGCCGAAGGCACTCAGACAGCTCAAGCCAGGACAGAACAGCTGCAGGGACAGTGACAG TGAAAGTGCCAGTGGAGAATCCAAGGGCTTCCACCGGAGCAGCTCTCGGGAAAGGCTCAGTGATAGTTCA GCTCCTTCCAGCTTGGGAACAGGCTACTTCAGATCAGGGAAGATGTGCCTTGGAGAGGAAGCATGTCTTA AATCTGGAAATGATATGAAGAGGGATGTCAGCAACACTTCATCCTGGGCCAGTAATAGGGAGAGTTTCTT TTCTCTCGTCAAATTGCTTAAAGGATTCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127232 |
ORF Size | 801 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001127232.2, NP_001120704.1 |
RefSeq Size | 1826 |
RefSeq ORF | 801 |
Locus ID | 26053 |
Gene Summary | This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014] Transcript Variant: This variant (3) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. The encoded protein (isoform 3) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225360 | AUTS2 (Myc-DDK-tagged)-Human autism susceptibility candidate 2 (AUTS2), transcript variant 3 |
USD 420.00 |
|
RG225360 | AUTS2 (GFP-tagged) - Human autism susceptibility candidate 2 (AUTS2), transcript variant 3 |
USD 460.00 |
|
RC225360L1 | Lenti ORF clone of Human autism susceptibility candidate 2 (AUTS2), transcript variant 3, Myc-DDK-tagged |
USD 768.00 |
|
RC225360L2 | Lenti ORF clone of Human autism susceptibility candidate 2 (AUTS2), transcript variant 3, mGFP tagged |
USD 620.00 |
|
RC225360L3 | Lenti ORF clone of Human autism susceptibility candidate 2 (AUTS2), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC225360L4 | Lenti ORF clone of Human autism susceptibility candidate 2 (AUTS2), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review