RHD (NM_001127691) Human Untagged Clone

CAT#: SC322974

RHD (untagged)-Human Rh blood group, D antigen (RHD), transcript variant 2


  "NM_001127691" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RHD
Synonyms CD240D; DIIIc; RH; Rh4; RH30; RHCED; RhDCw; RHDel; RHDVA(TT); RhII; RhK562-II; RhPI; RHPII; RHXIII
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001127691, the custom clone sequence may differ by one or more nucleotides
ATGAGCTCTAAGTACCCGCGGTCTGTCCGGCGCTGCCTGCCCCTCTGGGCCCTAACACTG
GAAGCAGCTCTCATTCTCCTCTTCTATTTTTTTACCCACTATGACGCTTCCTTAGAGGAT
CAAAAGGGGCTCGTGGCATCCTATCAAGTTGGCCAAGATCTGACCGTGATGGCGGCCATT
GGCTTGGGCTTCCTCACCTCGAGTTTCCGGAGACACAGCTGGAGCAGTGTGGCCTTCAAC
CTCTTCATGCTGGCGCTTGGTGTGCAGTGGGCAATCCTGCTGGACGGCTTCCTGAGCCAG
TTCCCTTCTGGGAAGGTGGTCATCACACTGTTCAGTATTCGGCTGGCCACCATGAGTGCT
TTGTCGGTGCTGATCTCAGTGGATGCTGTCTTGGGGAAGGTCAACTTGGCGCAGTTGGTG
GTGATGGTGCTGGTGGAGGTGACAGCTTTAGGCAACCTGAGGATGGTCATCAGTAATATC
TTCAACACAGACTACCACATGAACATGATGCACATCTACGTGTTCGCAGCCTATTTTGGG
CTGTCTGTGGCCTGGTGCCTGCCAAAGCCTCTACCCGAGGGAACGGAGGATAAAGATCAG
ACAGCAACGATACCCAGTTTGTCTGCCATGCTGGGCGCCCTCTTCTTGTGGATGTTCTGG
CCAAGTTTCAACTCTGCTCTGCTGAGAAGTCCAATCGAAAGGAAGAATGCCGTGTTCAAC
ACCTACTATGCTGTAGCAGTCAGCGTGGTGACAGCCATCTCAGGGTCATCCTTGGCTCAC
CCCCAAGGGAAGATCAGCAAGACTTATGTGCACAGTGCGGTGTTGGCAGGAGGCGTGGCT
GTGGGTACCTCGTGTCACCTGATCCCTTCTCCGTGGCTTGCCATGGTGCTGGGTCTTGTG
GCTGGGCTGATCTCCGTCGGGGGAGCCAAGTACCTGCCGTTTCCTCATTTGGCTGTTGGA
TTT
Restriction Sites Please inquire     
ACCN NM_001127691
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127691.1, NP_001121163.1
RefSeq Size 2545 bp
RefSeq ORF 966 bp
Locus ID 6007
Cytogenetics 1p36.11
Protein Families Transmembrane
Gene Summary 'The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene, which encodes the RhD protein, and a second gene that encodes both the RhC and RhE antigens on a single polypeptide. The two genes, and a third unrelated gene, are found in a cluster on chromosome 1. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2), also known as del789, lacks three alternate coding exons compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.