CCR2 (NM_001123396) Human Untagged Clone
CAT#: SC322997
CCR2 (untagged)-Human chemokine (C-C motif) receptor 2 (CCR2), transcript variant B
"NM_001123396" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CCR2 |
| Synonyms | CC-CKR-2; CCR-2; CCR2A; CCR2B; CD192; CKR2; CKR2A; CKR2B; CMKBR2; MCP-1-R |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001123396, the custom clone sequence may differ by one or more nucleotides
ATGCTGTCCACATCTCGTTCTCGGTTTATCAGAAATACCAACGAGAGCGGTGAAGAAGTCACCACCTTTT TTGATTATGATTACGGTGCTCCCTGTCATAAATTTGACGTGAAGCAAATTGGGGCCCAACTCCTGCCTCC GCTCTACTCGCTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCGTCCTCATCTTAATAAACTGC AAAAAGCTGAAGTGCTTGACTGACATTTACCTGCTCAACCTGGCCATCTCTGATCTGCTTTTTCTTATTA CTCTCCCATTGTGGGCTCACTCTGCTGCAAATGAGTGGGTCTTTGGGAATGCAATGTGCAAATTATTCAC AGGGCTGTATCACATCGGTTATTTTGGCGGAATCTTCTTCATCATCCTCCTGACAATCGATAGATACCTG GCTATTGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCA CCTGGTTGGTGGCTGTGTTTGCTTCTGTCCCAGGAATCATCTTTACTAAATGCCAGAAAGAAGATTCTGT TTATGTCTGTGGCCCTTATTTTCCACGAGGATGGAATAATTTCCACACAATAATGAGGAACATTTTGGGG CTGGTCCTGCCGCTGCTCATCATGGTCATCTGCTACTCGGGAATCCTGAAAACCCTGCTTCGGTGTCGAA ACGAGAAGAAGAGGCATAGGGCAGTGAGAGTCATCTTCACCATCATGATTGTTTACTTTCTCTTCTGGAC TCCCTATAATATTGTCATTCTCCTGAACACCTTCCAGGAATTCTTCGGCCTGAGTAACTGTGAAAGCACC AGTCAACTGGACCAAGCCACGCAGGTGACAGAGACTCTTGGGATGACTCACTGCTGCATCAATCCCATCA TCTATGCCTTCGTTGGGGAGAAGTTCAGAAGGTATCTCTCGGTGTTCTTCCGAAAGCACATCACCAAGCG CTTCTGCAAACAATGTCCAGTTTTCTACAGGGAGACAGTGGATGGAGTGACTTCAACAAACACGCCTTCC ACTGGGGAGCAGGAAGTCTCGGCTGGTTTATAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | Please inquire |
| ACCN | NM_001123396 |
| ORF Size | 1083 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001123396.1, NP_001116868.1 |
| RefSeq Size | 2335 |
| RefSeq ORF | 1083 |
| Locus ID | 729230 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a receptor for monocyte chemoattractant protein-1, a chemokine which specifically mediates monocyte chemotaxis. Monocyte chemoattractant protein-1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. The encoded protein mediates agonist-dependent calcium mobilization and inhibition of adenylyl cyclase. This protein can also be a coreceptor with CD4 for HIV-1 infection. This gene is located in the chemokine receptor gene cluster region of chromosome 3. [provided by RefSeq, Aug 2017] Transcript Variant: This variant (B) differs in the 3' UTR and 3' coding region, compared to variant A. The resulting isoform (B) is shorter and contains a distinct C-terminus, compared to isoform A. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225538 | CCR2 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 2 (CCR2), transcript variant B |
USD 457.00 |
|
| RG225538 | CCR2 (GFP-tagged) - Human chemokine (C-C motif) receptor 2 (CCR2), transcript variant B |
USD 460.00 |
|
| RC225538L3 | Lenti-ORF clone of CCR2 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 2 (CCR2), transcript variant B |
USD 768.00 |
|
| RC225538L4 | Lenti-ORF clone of CCR2 (mGFP-tagged)-Human chemokine (C-C motif) receptor 2 (CCR2), transcript variant B |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China
