CYP21A2 (NM_001128590) Human Untagged Clone

CAT#: SC323083

CYP21A2 (untagged)-Human cytochrome P450, family 21, subfamily A, polypeptide 2 (CYP21A2), transcript variant 2


  "NM_001128590" in other vectors (4)

Reconstitution Protocol

USD 780.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYP21A2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYP21A2
Synonyms CA21H; CAH1; CPS1; CYP21; CYP21B; P450c21B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001128590, the custom clone sequence may differ by one or more nucleotides


ATGCTGCTCCTGGGCCTGCTGCTGCTGCTGCCCCTGCTGGCTGGCGCCCGCCTGCTGTGGAACTGGTGGA
AGCTCCGGAGCCTCCACCTCCCGCCTCTTGCCCCGGGCTTCTTGCACCTGCTGCAGCCCGACCTCCCCAT
CTATCTGCTTGGCCTGACTCAGAAATTCGGGCCCATCTACAGGCTCCACCTTGGGCTGCAAGACAAGCTG
GTGTCTAGGAACTACCCGGACCTGTCCTTGGGAGACTACTCCCTGCTCTGGAAAGCCCACAAGAAGCTCA
CCCGCTCAGCCCTGCTGCTGGGCATCCGTGACTCCATGGAGCCAGTGGTGGAGCAGCTGACCCAGGAGTT
CTGTGAGCGCATGAGAGCCCAGCCCGGCACCCCTGTGGCCATTGAGGAGGAATTCTCTCTCCTCACCTGC
AGCATCATCTGTTACCTCACCTTCGGAGACAAGATCAAGGACGACAACTTAATGCCTGCCTATTACAAAT
GTATCCAGGAGGTGTTAAAAACCTGGAGCCACTGGTCCATCCAAATTGTGGACGTGATTCCCTTTCTCAG
GTTCTTCCCCAATCCAGGTCTCCGGAGGCTGAAGCAGGCCATAGAGAAGAGGGATCACATCGTGGAGATG
CAGCTGAGGCAGCACAAGGAGAGCCTCGTGGCAGGCCAGTGGAGGGACATGATGGACTACATGCTCCAAG
GGGTGGCGCAGCCGAGCATGGAAGAGGGCTCTGGACAGCTCCTGGAAGGGCACGTGCACATGGCTGCAGT
GGACCTCCTGATCGGTGGCACTGAGACCACAGCAAACACCCTCTCCTGGGCCGTGGTTTTTTTGCTTCAC
CACCCTGAGATTCAGCAGCGACTGCAGGAGGAGCTAGACCACGAACTGGGCCCTGGTGCCTCCAGCTCCC
GGGTCCCCTACAAGGACCGTGCACGGCTGCCCTTGCTCAATGCCACCATCGCCGAGGTGCTGCGCCTGCG
GCCCGTTGTGCCCTTAGCCTTGCCCCACCGCACCACACGGCCCAGCAGCATCTCCGGCTACGACATCCCT
GAGGGCACAGTCATCATTCCGAACCTCCAAGGCGCCCACCTGGATGAGACGGTCTGGGAGAGGCCACATG
AGTTCTGGCCTGATCGCTTCCTGGAGCCAGGCAAGAACTCCAGAGCTCTGGCCTTCGGCTGCGGTGCCCG
CGTGTGCCTGGGCGAGCCGCTGGCGCGCCTGGAGCTCTTCGTGGTGCTGACCCGACTGCTGCAGGCCTTC
ACGCTGCTGCCCTCCGGGGACGCCCTGCCCTCCCTGCAGCCCCTGCCCCACTGCAGTGTCATCCTCAAGA
TGCAGCCTTTCCAAGTGCGGCTGCAGCCCCGGGGGATGGGGGCCCACAGCCCGGGCCAGAGCCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001128590
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001128590.3, NP_001122062.3
RefSeq Size 2041 bp
RefSeq ORF 1398 bp
Locus ID 1589
Cytogenetics 6p21.33
Protein Families Druggable Genome, P450
Protein Pathways C21-Steroid hormone metabolism, Metabolic pathways
Gene Summary 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates steroids at the 21 position. Its activity is required for the synthesis of steroid hormones including cortisol and aldosterone. Mutations in this gene cause congenital adrenal hyperplasia. A related pseudogene is located near this gene; gene conversion events involving the functional gene and the pseudogene are thought to account for many cases of steroid 21-hydroxylase deficiency. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.