SCN4B (NM_001142349) Human Untagged Clone

CAT#: SC324716

SCN4B (untagged)-Human sodium channel, voltage-gated, type IV, beta (SCN4B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCN4B
• Synonyms: ATFB17; LQT10; Navbeta4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC324716 sequence for NM_001142349 edited (data generated by NextGen Sequencing)
  
  
  ATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGA
  AGAACCCCAAGGAGAATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGA
  AGTGGACAACACAGTGACACTCATCATCCTGGCTGTCGTGGGCGGGGTCATCGGGCTCCTCATCCTCATC
  CTGCTGATCAAGAAACTCATCATCTTCATCCTGAAGAAGACTCGGGAGAAGAAGAAGGAGTGTCTCGTGA
  GCTCCTCGGGGAATGACAACACGGAGAACGGCTTGCCTGGCTCCAAGGCAGAGGAGAAACCACCTTCAAA
  AGTGTGA
  
  Clone variation with respect to NM_001142349.1
  
• Restriction Sites: Please inquire
• ACCN: NM_001142349
• Insert Size: 4500 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142349.1, NP_001135821.1
• RefSeq Size: 4516 bp
• RefSeq ORF: 357 bp
• Locus ID: 6330
• Cytogenetics: 11q23.3
• Protein Families: Ion Channels: Sodium, Transmembrane
• Gene Summary: 'The protein encoded by this gene is one of several sodium channel beta subunits. These subunits interact with voltage-gated alpha subunits to change sodium channel kinetics. The encoded transmembrane protein forms interchain disulfide bonds with SCN2A. Defects in this gene are a cause of long QT syndrome type 10 (LQT10). Three protein-coding and one non-coding transcript variant have been found for this gene.[provided by RefSeq, Mar 2009]'
  Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at an in-frame downstream ATG and an isoform (3) which has a shorter N-terminus, compared to isoform 1. Translation initiation from the start codon 197 nucleotides upstream would subject the transcript to nonsense-mediated mRNA decay (NMD).