14-3-3 zeta (YWHAZ) (NM_001135701) Human Untagged Clone

CAT#: SC324833

YWHAZ (untagged)-Human tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: YWHAZ
• Synonyms: 14-3-3-zeta; HEL-S-3; HEL-S-93; HEL4; KCIP-1; POPCHAS; YWHAD
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135701, the custom clone sequence may differ by one or more nucleotides
  ATGGATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGAT
  GACATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAG
  AGGAATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGG
  GTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGA
  GAATACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTT
  TTGGAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAA
  ATGAAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGG
  ATTGTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATG
  CAACCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAG
  ATTCTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATT
  GCTGAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTA
  CTGAGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGA
  GAAGGAGGGGAAAAT
  
• Restriction Sites: Please inquire
• ACCN: NM_001135701
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135701.1, NP_001129173.1
• RefSeq Size: 3023 bp
• RefSeq ORF: 738 bp
• Locus ID: 7534
• Cytogenetics: 8q22.3
• Protein Pathways: Cell cycle, Neurotrophin signaling pathway, Oocyte meiosis, Pathogenic Escherichia coli infection
• Gene Summary: 'This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and sheep orthologs. The encoded protein interacts with IRS1 protein, suggesting a role in regulating insulin sensitivity. Several transcript variants that differ in the 5' UTR but that encode the same protein have been identified for this gene. [provided by RefSeq, Oct 2008]'
  Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 2. All six transcripts encode the same protein.