BAP31 (BCAP31) (NM_001139441) Human Untagged Clone

CAT#: SC324837

BCAP31 (untagged)-Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCAP31
• Synonyms: 6C6-AG; BAP31; CDM; DDCH; DXS1357E
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001139441 edited
  ATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTG
  CTTCTCTGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTG
  GTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTG
  CTGTTGGTCATCGATGCCGTGCGCGAAATTCGGGAGTATGATGATGTGACGGAAAAGGTG
  AACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAG
  AGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTG
  ACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCG
  GAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGA
  GCTGCTGTTGACGGAGGCAAGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAG
  AACAGGAGCCTGAAGGCTGACCTGCAGAAGCTAAAGGACGAGCTGGCCAGCACTAAGCAA
  AAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGGAAGCAGTCTGAGGGCCTCACC
  AAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAGTAGATGGTCCC
  ATGGACAAGAAGGAAGAGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001139441
• ORF Size: 741 bp
• Insert Size: 700
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001139441.1, NP_001132913.1
• RefSeq Size: 1346
• RefSeq ORF: 741
• Locus ID: 10134
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the B-cell receptor associated protein 31 superfamily. The encoded protein is a multi-pass transmembrane protein of the endoplasmic reticulum that is involved in the anterograde transport of membrane proteins from the endoplasmic reticulum to the Golgi and in caspase 8-mediated apoptosis. Microdeletions in this gene are associated with contiguous ABCD1/DXS1375E deletion syndrome (CADDS), a neonatal disorder. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 16. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3 and 4 all encode isoform b.