RAB34 (NM_001144942) Human Untagged Clone

CAT#: SC324850

RAB34 (untagged)-Human RAB34, member RAS oncogene family (RAB34), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB34
• Synonyms: NARR; RAB39; RAH
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001144942, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAGG
  CCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCACCGGACAGGCAC
  CGTGGGATTTAAGATCTCCAAGGTCATTGTGGTGGGGGACCTGTCGGTGGGGAAGACTTGCCTCATTAAT
  AGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAACGAT
  TTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAATGCAT
  TGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATCTCTG
  GAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTCCTTA
  CCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGGTGGCCCAGGAGATGAAGGCTGAGTACTG
  GGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTTCTTCCGTGTGGCAGCACTGACCTTTGAG
  GCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGACGCATTGGGGATGTTGTCCGCATCAACAGTG
  ATGACAGCAACCTCTACCTAACTGCCAGCAAGAAGAAGCCCACATGTTGCCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001144942
• ORF Size: 756 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001144942.1, NP_001138414.1
• RefSeq Size: 1761
• RefSeq ORF: 756
• Locus ID: 83871
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
  Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (4) is shorter than isoform 1.