EMAP II (AIMP1) (NM_001142416) Human Untagged Clone
CAT#: SC324959
AIMP1 (untagged)-Human aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 (AIMP1), transcript variant 3
"NM_001142416" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AIMP1 |
Synonyms | EMAP2; EMAPII; HLD3; p43; SCYE1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001142416, the custom clone sequence may differ by one or more nucleotides
ATGCTTCCTGCTGTGGCTGTCTCGGAACCCGTGGTCCTCCGCTTCATGATTTTCTGCCGTCTCTTGGCAA AAATGGCAAATAATGATGCTGTTCTGAAGAGACTGGAGCAGAAGGGTGCAGAGGCAGATCAAATCATTGA ATATCTTAAGCAGCAAGTTTCTCTACTTAAGGAGAAAGCAATTTTGCAGGCAACTTTGAGGGAAGAGAAG AAACTTCGAGTTGAAAATGCTAAACTGAAGAAAGAAATTGAAGAACTGAAACAAGAGCTAATTCAGGCAG AAATTCAAAATGGAGTGAAGCAAATACCATTTCCATCTGGTACTCCACTGCACGCTAATTCTATGGTTTC TGAAAATGTGATACAGTCTACAGCAGTAACAACCGTATCTTCTGGTACCAAAGAACAGATAAAAGGAGGA ACAGGAGACGAAAAGAAAGCGAAAGAGAAAATTGAAAAGAAAGGAGAGAAGAAGGAGAAAAAACAGCAAT CAATAGCTGGAAGTGCCGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGAATTGGTTGCATCAT AACTGCTAGAAAACACCCTGATGCAGATTCTTTGTATGTGGAAGAAGTAGATGTCGGAGAAATAGCCCCA AGGACAGTTGTCAGTGGCCTGGTGAATCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTAC TTTGTAACCTGAAACCTGCAAAGATGAGGGGAGTATTATCTCAAGCAATGGTCATGTGTGCTAGTTCACC AGAGAAAATTGAAATCTTGGCTCCTCCAAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTC CCAGGAGAGCCTGACAAGGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTCACA CTAATGATGAGTGTGTGGCTACATACAAAGGAGTTCCCTTTGAGGTGAAAGGGAAGGGAGTATGTAGGGC TCAAACCATGAGCAACAGTGGAATCAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142416 |
ORF Size | 1011 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001142416.1, NP_001135888.1 |
RefSeq Size | 2598 |
RefSeq ORF | 1011 |
Locus ID | 9255 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008] Transcript Variant: This variant (3) differs in the 5' UTR and includes an additional segment in the 5' coding region, compared to variant 1. The resulting isoform (b) is longer at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to start at a downstream in-frame start codon that is supported by conservation data. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227107 | AIMP1 (Myc-DDK-tagged)-Human aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 (AIMP1), transcript variant 3 |
USD 420.00 |
|
RG227107 | AIMP1 (GFP-tagged) - Human aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 (AIMP1), transcript variant 3 |
USD 460.00 |
|
RC227107L3 | Lenti ORF clone of Human aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 (AIMP1), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC227107L4 | Lenti ORF clone of Human aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 (AIMP1), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review