KCNK16 (NM_001135107) Human Untagged Clone
CAT#: SC325680
KCNK16 (untagged)-Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 4
"NM_001135107" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNK16 |
Synonyms | K2p16.1; TALK-1; TALK1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001135107, the custom clone sequence may differ by one or more nucleotides
ATGCCCAGTGCTGGGCTCTGCAGCTGCTGGGGTGGCCGGGTGCTGCCCCTGCTGCTGGCCTATGTCTGCT ACCTGCTGCTCGGTGCCACTATCTTCCAGCTGCTAGAGAGGCAGGCGGAGGCTCAGTCCAGGGACCAGTT TCAGTTGGAGAAGCTGCGCTTCCTGGAGAACTACACCTGCCTGGACCAGTGGGCCATGGAGCAGTTTGTG CAGGTCATCATGGAAGCCTGGGTGAAAGGTGTGAACCCCAAAGGCAACTCTACCAACCCCAGCAACTGGG ACTTTGGCAGCAGTTTCTTCTTTGCAGGCACAGTCGTCACTACCATAGGATATGGGAACCTGGCACCCAG CACAGAGGCAGGTCAGGTCTTCTGTGTCTTCTATGCCCTGTTGGGCATCCCGCTTAACGTGATCTTCCTC AACCACCTGGGCACAGGGCTGCGTGCCCATCTGGCCGCCATTGAAAGATGGGAGGACCGTCCCAGGCGCT CCCAGGTACTGCAAGTCCTGGGCCTGGCTCTGTTCCTGACCCTGGGGACGCTGGTCATTCTCATCTTCCC ACCCATGGTCTTCAGCCATGTGGAGGGCTGGAGCTTCAGCGAGGGCTTCTACTTTGCTTTCATCACTCTC AGCACCATTGGCTTTGGGGACTATGTTGTTGGTCTGAGGCAAGGCTGTGGAGCCAAGGCGGCTCCAGGCA GGAGACCCAGGAGAGGCTCTACAGCAGCAAGAGGAGTCCAAGTCACACCCCAGGACTTCCCCATATCCAA GAAAGGACTGGGAAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135107 |
ORF Size | 789 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001135107.1, NP_001128579.1 |
RefSeq Size | 1110 |
RefSeq ORF | 789 |
Locus ID | 83795 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is expressed predominantly in the pancreas and is activated at alkaline pH. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008] Transcript Variant: This variant (4, also known as TALK-1d) uses a different acceptor splice site at the 3' terminal exon compared to transcript variant 1, resulting in a shorter isoform (4) with a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225354 | KCNK16 (Myc-DDK-tagged)-Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 4 |
USD 420.00 |
|
RG225354 | KCNK16 (GFP-tagged) - Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 4 |
USD 460.00 |
|
RC225354L3 | Lenti ORF clone of Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC225354L4 | Lenti ORF clone of Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review