RAB34 (NM_001142625) Human Untagged Clone

CAT#: SC325688

RAB34 (untagged)-Human RAB34, member RAS oncogene family (RAB34), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB34
• Synonyms: NARR; RAB39; RAH
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142625, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTCACCTCCCAGGCCTGGAGTTGAGGAGGGAAGCGCCGCCTCTCCTTGGGCCCCTTCTCTCCCCCT
  TTCCCCTCCCTGCTGGTTCCTGGCATCGCCAGATGCTGCGCAGCAGTCTCCGATTCCCCATCACCAATTC
  GGCTGGGGCGCCCTGCAAGGCCGCAGGCAGGATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTG
  GCGGAGCTGCCCCAGTGCCTGAGGAAGGAGGCCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCA
  CCTGCGCCTGCCAGGAGCACCGGACAGGCACCGTGGGCAGATTTAAGATCTCCAAGGTCATTGTGGTGGG
  GGACCTGTCGGTGGGGAAGACTTGCCTCATTAATAGGTTCTGCAAAGACACCTTTGATAAGAATTACAAG
  GCCACCATTGGAGTGGACTTCGAGATGGAACGATTTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTT
  GGGATACCGCTGGGCAGGAGAGGTTCAAATGCATTGCATCAACCTACTATAGAGGAGCTCAAGCCATCAT
  CATTGTCTTCAACCTGAATGATGTGGCATCTCTGGAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAG
  GAGAATGACCCTTCCAGTGTGCTTCTCTTCCTTGTAGGTTCCAAGAAGGATCTGAGTACCCCTGCTCAGT
  ATGCGCTGATGGAGAAAGACGCCCTCCAGGTGGCCCAGGAGATGAAGACTGTTCAGAGACTGCCCAGCCC
  TAGGGCACTGTGCCACCCTCATTCCTCCAGAGCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142625
• ORF Size: 807 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142625.2, NP_001136097.2
• RefSeq Size: 1118
• RefSeq ORF: 807
• Locus ID: 83871
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
  Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, and lacks an internal segment in the 3' coding region, compared to variant 1. The resulting isoform (3) has distinct N- and C-termini and is longer than isoform 1.