CNGB1 (NM_001135639) Human Untagged Clone

CAT#: SC325738

CNGB1 (untagged)-Human cyclic nucleotide gated channel beta 1 (CNGB1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CNGB1
• Synonyms: CNCG2; CNCG3L; CNCG4; CNG4; CNGB1B; GAR1; GARP; GARP2; RCNC2; RCNCb; RCNCbeta; RP45
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135639, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTGGGCTGGGTCCAGAGGGTGCTGCCTCAGCCCCCAGGGACCCCTCGGAAGACCAAGATGCAGGAGG
  AAGAGGAAGTGGAACCAGAGCCAGAGATGGAGGCGGAGGTGGAACCAGAACCGAATCCTGAGGAGGCCGA
  GACAGAGTCCGAGTCCATGCCCCCCGAAGAGTCATTCAAGGAGGAGGAAGTGGCTGTGGCAGACCCAAGC
  CCTCAGGAGACCAAGGAGGCTGCCCTTACTTCCACCATATCCCTCCGGGCCCAGGGCGCTGAGATTTCTG
  AAATGAATAGTCCCAGCCGCAGGGTACTGACCTGGCTCATGAAGGGCGTAGAGAAGGTGATCCCGCAGCC
  TGTTCACAGCATCACGGAGGACCCGGCTCAGATCCTGGGGCATGGCAGCACTGGGGACACAGGGTGCACA
  GATGAACCCAATGAGGCCCTTGAGGCCCAAGACACTAGGCCTGGGCTGCGGCTGCTTCTGTGGCTGGAGC
  AGAATCTGGAAAGAGTGCTTCCTCAGCCCCCCAAATCCTCTGAGGTCTGGAGAGATGAGCCTGCAGTTGC
  TACAGGTGCTGCCTCAGACCCAGCGCCTCCAGGACGCCCCCAGGAAATGGGGCCCAAGCTGCAGGCCCGG
  GAGACCCCCTCCCTGCCCACACCCATCCCCCTGCAGCCCAAGGAGGAACCCAAGGAGGCACCAGCTCCAG
  AGCCCCAGCCCGGCTCCCAGGCCCAGACCTCCTCCCTGCCACCAACCAGGGACCCTGCCAGGCTGGTGGC
  ATGGGTCCTGCACAGGCTGGAGATGGCCTTGCCGCAGCCAGTGCTACATGGGAAAATAGGGGAACAGGAG
  CCTGACTCCCCTGGGATATGTGATGTGCAGACCAGGGTGATGGGAGCTGGAGGTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135639
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135639.1, NP_001129111.1
• RefSeq Size: 1648 bp
• RefSeq ORF: 900 bp
• Locus ID: 1258
• Cytogenetics: 16q21
• Protein Families: Druggable Genome, Ion Channels: Cyclic nucleotide gated
• Protein Pathways: Olfactory transduction
• Gene Summary: 'In humans, the rod photoreceptor cGMP-gated cation channel helps regulate ion flow into the rod photoreceptor outer segment in response to light-induced alteration of the levels of intracellular cGMP. This channel consists of two subunits, alpha and beta, with the protein encoded by this gene representing the beta subunit. Defects in this gene are a cause of cause of retinitis pigmentosa type 45. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]'
  Transcript Variant: This variant (2) uses an alternate exon and lacks the 3' coding region, compared to variant 1. The resulting isoform (b), also known as GARP2, is much shorter and has a unique C-terminus, compared to isoform a.