RAB34 (NM_001142624) Human Untagged Clone

CAT#: SC325751

RAB34 (untagged)-Human RAB34, member RAS oncogene family (RAB34), transcript variant 2


  "NM_001142624" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAB34"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB34
Synonyms NARR; RAB39; RAH
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001142624, the custom clone sequence may differ by one or more nucleotides
ATGAGTCACCTCCCAGGCCTGGAGTTGAGGAGGGAAGCGCCGCCTCTCCTTGGGCCCCTT
CTCTCCCCCTTTCCCCTCCCTGCTGGTTCCTGGCATCGCCAGATGCTGCGCAGCAGTCTC
CGATTCCCCATCACCAATTCGGCTGGGGCGCCCTGCAAGGCCGCAGGCAGGATGAACATT
CTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAG
GCCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCAC
CGGACAGGCACCGTGGGATTTAAGATCTCCAAGGTCATTGTGGTGGGGGACCTGTCGGTG
GGGAAGACTTGCCTCATTAATAGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCC
ACCATTGGAGTGGACTTCGAGATGGAACGATTTGAGGTGCTGGGCATTCCCTTCAGTTTG
CAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAATGCATTGCATCAACCTACTATAGA
GGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATCTCTGGAACATACC
AAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTCCTT
ACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGGTGGCCCAGGAGATGAAG
GCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTTCTTCCGT
GTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGA
CGCATTGGGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGC
AAGAAGAAGCCCACATGTTGCCCA
Restriction Sites Please inquire     
ACCN NM_001142624
ORF Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142624.2, NP_001136096.2
RefSeq Size 1309
RefSeq ORF 927
Locus ID 83871
Protein Families Druggable Genome
Gene Summary This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (2) has a distinct N-terminus and is longer than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.