BAP31 (BCAP31) (NM_001139457) Human Untagged Clone
CAT#: SC325756
BCAP31 (untagged)-Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 1
"NM_001139457" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCAP31 |
Synonyms | 6C6-AG; BAP31; CDM; DDCH; DXS1357E |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001139457, the custom clone sequence may differ by one or more nucleotides
ATGGGTGCCGAGGCGTCCTCCTCTTGGTGCCCTGGCACTGCTCTTCCCGAAGAACGCCTTTCAGTTAAAC GGGCGTCGGAAATCTCGGGCTTCCTGGGGCAGGGATCGTCGGGAGAGGCCGCTCTGGACGTGTTGACACA CGTGCTGGAGGGGGCAGGAAACAAGCTCACATCTTCCTGTGGGAAACCTTCTAGCAACAGGATGAGTCTG CAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTGCTTCTCTGCATTCCCTTCA TTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACAC CTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTAT GATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTT TCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGT GACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCT AGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGACGGAGGCA AGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAGAACAGGAGCCTGAAGGCTGACCTGCAGAA GCTAAAGGACGAGCTGGCCAGCACTAAGCAAAAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGG AAGCAGTCTGAGGGCCTCACCAAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAG TAGATGGTCCCATGGACAAGAAGGAAGAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001139457 |
ORF Size | 942 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001139457.2, NP_001132929.1 |
RefSeq Size | 1828 |
RefSeq ORF | 942 |
Locus ID | 10134 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the B-cell receptor associated protein 31 superfamily. The encoded protein is a multi-pass transmembrane protein of the endoplasmic reticulum that is involved in the anterograde transport of membrane proteins from the endoplasmic reticulum to the Golgi and in caspase 8-mediated apoptosis. Microdeletions in this gene are associated with contiguous ABCD1/DXS1375E deletion syndrome (CADDS), a neonatal disorder. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 16. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227334 | BCAP31 (Myc-DDK-tagged)-Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 1 |
USD 420.00 |
|
RG227334 | BCAP31 (GFP-tagged) - Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 1 |
USD 460.00 |
|
RC227334L1 | Lenti ORF clone of Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC227334L2 | Lenti ORF clone of Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC227334L3 | Lenti ORF clone of Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC227334L4 | Lenti ORF clone of Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review