MEF2A (NM_001130927) Human Untagged Clone

CAT#: SC325922

MEF2A (untagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 3


  "NM_001130927" in other vectors (4)

Reconstitution Protocol

USD 740.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MEF2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MEF2A
Synonyms ADCAD1; mef2; RSRFC4; RSRFC9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001130927, the custom clone sequence may differ by one or more nucleotides


ATGGGGCGGAAGAAAATACAAATCACACGCATAATGGATGAAAGGAACCGACAGACTTTAAGAAAGAAAG
GCCTTAATGGTTGTGAGAGCCCTGATGCTGACGATTACTTTGAGCACAGTCCACTCTCGGAGGACAGATT
CAGCAAACTAAATGAAGATAGTGATTTTATTTTCAAACGAGGCCCTCCTGGTCTGCCACCTCAGAACTTT
TCAATGTCTGTCACAGTTCCAGTGACCAGCCCCAATGCTTTGTCCTACACTAACCCAGGGAGTTCACTGG
TGTCCCCATCTTTGGCAGCCAGCTCAACGTTAACAGATTCAAGCATGCTCTCTCCACCTCAAACCACATT
ACATAGAAATGTGTCTCCTGGAGCTCCTCAGAGACCACCAAGTACTGGCAATGCAGGTGGGATGTTGAGC
ACTACAGACCTCACAGTGCCAAATGGAGCTGGAAGCAGTCCAGTGGGGAATGGATTTGTAAACTCAAGAG
CTTCTCCAAATTTGATTGGAGCTACTGGTGCAAATAGCTTAGGCAAAGTCATGCCTACAAAGTCTCCCCC
TCCACCAGGTGGTGGTAATCTTGGAATGAACAGTAGGAAACCAGATCTTCGAGTTGTCATCCCCCCTTCA
AGCAAGGGCATGATGCCTCCACTATCGGAGGAAGAGGAATTGGAGTTGAATACCCAGAGGATCAGTAGTT
CTCAAGCCACTCAACCTCTTGCTACCCCAGTCGTGTCTGTGACAACCCCAAGCTTGCCTCCGCAAGGACT
TGTGTACTCAGCAATGCCGACTGCCTACAACACTGATTATTCACTGACCAGCGCTGACCTGTCAGCCCTT
CAAGGCTTCAACTCGCCAGGAATGCTGTCGCTGGGACAGGTGTCGGCCTGGCAGCAGCACCACCTAGGAC
AAGCAGCCCTCAGCTCTCTTGTTGCTGGAGGGCAGTTATCTCAGGGTTCCAATTTATCCATTAATACCAA
CCAAAACATCAGCATCAAGTCCGAACCGATTTCACCTCCTCGGGATCGTATGACCCCATCGGGCTTCCAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCACCACCGCAGCCCCAGCCACAACCCCCGCAGC
CCCAGCCCCGACAGGAAATGGGGCGCTCCCCTGTGGACAGTCTGAGCAGCTCTAGTAGCTCCTATGATGG
CAGTGATCGGGAGGATCCACGGGGCGACTTCCATTCTCCAATTGTGCTTGGCCGACCCCCAAACACTGAG
GACAGAGAAAGCCCTTCTGTAAAGCGAATGAGGATGGACGCGTGGGTGACCTAA


Restriction Sites SgfI-RsrII     
ACCN NM_001130927
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130927.2, NP_001124399.1
RefSeq Size 5368 bp
RefSeq ORF 1314 bp
Locus ID 4205
Cytogenetics 15q26.3
Protein Families Transcription Factors
Gene Summary 'The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]'
Transcript Variant: This variant (3) lacks an in-frame 5' coding exon and a 5' non-coding exon, compared to transcript variant 6. These differences result in a shorter isoform (3), compared to isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.