PDHX (NM_001135024) Human Untagged Clone

CAT#: SC325983

PDHX (untagged)-Human pyruvate dehydrogenase complex, component X (PDHX), transcript variant 2


  "NM_001135024" in other vectors (4)

Reconstitution Protocol

USD 820.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PDHX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDHX
Synonyms DLDBP; E3BP; OPDX; PDHXD; PDX1; proX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135024, the custom clone sequence may differ by one or more nucleotides


ATGCAATCAGGCGGCGCTGAGGGCAGCCCGGGGGCGGGGCGAACGGGGCGGGGGCCGGGGTCTGGTAAGG
CCCCGCCGGCTGAGATATCCAGCGGCGCACCTGACTTCCCGGGAGGTGATCCCATTAAGATACTAATGCC
ATCACTGTCTCCTACAATGGAAGAAGGAAACATTGTGAAATGGCTGAAAAAGGAAGGTGAAGCGGTGAGT
GCTGGAGATGCATTATGTGAAATTGAGACTGACAAAGCTGTGGTTACCTTAGATGCAAGTGATGATGGAA
TCTTGGCCAAAATCGTGGTTGAAGAAGGAAGTAAAAATATACGGCTAGGTTCACTAATTGGTTTGATAGT
AGAAGAAGGAGAAGATTGGAAACATGTTGAAATTCCCAAAGACGTAGGTCCTCCACCACCAGTTTCAAAA
CCTTCAGAGCCTCGCCCCTCACCAGAACCACAGATTTCCATCCCTGTCAAGAAGGAACACATACCCGGGA
CACTACGGTTCCGTTTAAGTCCAGCTGCCCGCAATATTCTGGAAAAACACTCACTGGATGCTAGCCAGGG
CACAGCCACTGGCCCTCGGGGGATATTCACTAAAGAGGATGCTCTCAAACTTGTCCAGTTGAAACAAACG
GGCAAGATTACCGAGTCCAGACCAACTCCAGCCCCCACAGCCACTCCCACAGCACCTTCGCCCCTACAGG
CCACAGCTGGACCATCTTATCCCCGGCCTGTGATCCCACCAGTATCAACTCCTGGACAACCCAATGCAGT
GGGCACATTCACTGAAATCCCCGCCAGCAATATTCGAAGAGTTATTGCCAAGAGATTAACTGAATCTAAA
AGTACTGTACCTCATGCATATGCTACTGCTGACTGTGACCTTGGAGCTGTTTTAAAAGTTAGGCAAGATC
TGGTCAAAGATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAACA
AATGCCAGATGTTAATGTAAGCTGGGATGGAGAGGGCCCAAAGCAACTGCCATTTATTGACATTTCAGTG
GCTGTGGCAACAGATAAAGGCTTACTTACTCCAATCATAAAAGATGCTGCTGCTAAAGGTATCCAGGAAA
TTGCTGACTCTGTAAAGGCTCTATCAAAGAAAGCAAGAGATGGAAAATTGTTGCCTGAAGAATACCAAGG
AGGATCTTTTAGTATTTCCAACTTGGGGATGTTTGGCATCGACGAATTTACTGCAGTGATTAACCCTCCT
CAGGCCTGCATTTTGGCGGTTGGGAGGTTCCGACCTGTGCTGAAGCTCACTGAGGATGAAGAGGGAAATG
CCAAACTGCAGCAGCGCCAGCTCATAACAGTCACAATGTCAAGTGACAGTCGAGTGGTTGATGACGAACT
GGCAACCAGGTTTCTTAAAAGTTTTAAAGCAAACCTAGAGAATCCTATCCGACTTGCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001135024
ORF Size 1461 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001135024.1, NP_001128496.1
RefSeq Size 2662
RefSeq ORF 1461
Locus ID 8050
Gene Summary The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) lacks a segment in the 5' region, resulting in upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.