Troponin I fast skeletal muscle (TNNI2) (NM_001145829) Human Untagged Clone

CAT#: SC326450

TNNI2 (untagged)-Human troponin I type 2 (skeletal, fast) (TNNI2), transcript variant 2, mRNA


  "NM_001145829" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TNNI2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TNNI2
Synonyms AMCD2B; DA2B; DA2B1; FSSV; fsTnI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145829, the custom clone sequence may differ by one or more nucleotides


ATGGGAGATGAGGAGAAGCGGAACAGGGCCATCACGGCCCGCAGGCAGCACCTGAAGAGTGTGATGCTGC
AGATAGCGGCCACGGAGCTGGAGAAGGAGGAGAGCCGCCGTGAGGCAGAGAAGCAGAACTACCTGGCGGA
GCACTGCCCGCCGCTGCATATCCCGGGCTCCATGTCTGAAGTGCAGGAGCTCTGCAAACAGCTGCACGCC
AAGATCGATGCGGCTGAAGAGGAGAAGTACGACATGGAGGTGAGGGTGCAGAAGACCAGCAAGGAGCTGG
AGGACATGAACCAGAAGCTATTTGATCTGCGGGGCAAGTTCAAGCGGCCCCCACTGCGGAGGGTGCGCAT
GTCGGCCGATGCCATGCTCAAGGCCCTGCTGGGCTCGAAGCACAAGGTGTGCATGGACCTGAGGGCCAAC
CTGAAGCAGGTCAAGAAGGAGGACACAGAGAAGGAGCGGGACCTGCGAGACGTGGGTGACTGGAGGAAGA
ACATCGAGGAGAAGTCTGGCATGGAGGGCCGGAAGAAGATGTTTGAGTCCGAGTCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001145829
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145829.1, NP_001139301.1
RefSeq Size 746 bp
RefSeq ORF 549 bp
Locus ID 7136
Cytogenetics 11p15.5
Gene Summary 'This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]'
Transcript Variant: This variant (2) has an alternate 5' UTR exon, and encodes the same isoform 1, as compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.