ST6GALNAC3 (NM_001160011) Human Untagged Clone
CAT#: SC326777
ST6GALNAC3 (untagged)-Human ST6 (alpha-N-acetyl-neuraminyl-23-beta-galactosyl-13)-N-acetylgalactosaminide alpha-26-sialyltransferase 3 (ST6GALNAC3) transcript variant 2
"NM_001160011" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ST6GALNAC3 |
Synonyms | PRO7177; SIAT7C; ST6GALNACIII; STY |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001160011, the custom clone sequence may differ by one or more nucleotides
ATGGCCTGCATCCTGAAGAGAAAGTCTGTGATTGCTGTGAGCTTCATAGCAGCGTTCCTTTTCCTGCTGG TTGTGCGTCTTGTAAATGAAGTGAATTTCCCATTGCTACTAAACTGCTTTGGACAACCTGGTACAAAGTG GATACCATTCTCCTACACATACAGGCGGCCCCTTCGAACTCACTATGGATACATAAATGTGAAGACACAA GAGCCTTTGCAACTGGACTGTGACCTTTGTGCCATAGTGTCAAACTCAGGTCAGATGGTTGGCCAGAAGG TGGGAAATGAGATAGATCGATCCTCCTGCATTTGGAGAATGAACAATGCCCCCACCAAAGGTTATGAAGA AGATGTCGGCCGCATGACCATGATTCGAGTTGTGTCCCATACCAGCGTTCCTCTTTTGCTAAAAAACCCT GATTATTTTTTCAAGGAAGCGAATACTACTATTTATGTTATTTGGGGACCTTTCCGCAATATGAGGAAAG ATGGCAATGGCATCGTTTACAACATGTTGAAAAAGACAGTTGGTATCTATCCGAATGCCCAAATATACGT GACCACAGAGAAGCGCATGAGTTACTGTGATGGAGTTTTTAAGAAGGAAACTGGGAAGGACAGTACAGAG TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001160011 |
ORF Size | 633 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001160011.1, NP_001153483.1 |
RefSeq Size | 1171 |
RefSeq ORF | 633 |
Locus ID | 256435 |
Protein Families | Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - ganglio series, Metabolic pathways |
Gene Summary | ST6GALNAC3 belongs to a family of sialyltransferases that transfer sialic acids from CMP-sialic acid to terminal positions of carbohydrate groups in glycoproteins and glycolipids (Lee et al., 1999 [PubMed 10207017]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228142 | ST6GALNAC3 (Myc-DDK-tagged)-Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 2 |
USD 420.00 |
|
RG228142 | ST6GALNAC3 (GFP-tagged) - Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 2 |
USD 460.00 |
|
RC228142L3 | Lenti ORF clone of Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228142L4 | Lenti ORF clone of Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review