MS4A12 (NM_001164470) Human Untagged Clone

CAT#: SC326786

MS4A12 (untagged)-Human membrane-spanning 4-domains subfamily A member 12 (MS4A12) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MS4A12
• Synonyms: Ms4a10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164470, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGTCATCCAAGCCAACAAGCCATGCTGAAGTAAATGAAACCATACCCAACCCTTACCCACCAAGCA
  GCTTTATGGCTCCTGGATTTCAACAGCCTCTGGGTTCAATCAACTTAGAAAACCAAGCTCAGGGTGCTCA
  GCGTGCTCAGCCCTACGGCATCACATCTCCGGGAATCTTTGCTAGCAGTCAACCGGGTCAAGGAAATATA
  CAAATGATAAATCCAAGTGTGGGAACAGCAGTAATGAACTTTAAAGAAGAAGCAAAGGCACTAGGGTTTA
  TTATCTCTGGCTCTCTCTCTGTGTCAGCATCCAAGGAGCTTTCCCGTTGTCTGGTGAAAGGCAGCCTGGG
  AATGAACATTGTTAGTTCTATCTTGGCCTTCATTGGAGTGATTCTGCTGCTGGTGGATATGTGCATCAAT
  GGGGTAGCTGGCCAAGACTACTGGGCCGTGCTTTCTGGAAAAGGCATTTCAGCCACGCTGATGATCTTCT
  CCCTCTTGGAGTTCTTCGTAGCTTGTGCCACAGCCCATTTTGCCAACCAAGCAAACACCACAACCAATAT
  GTCTGTCCTGGTTATTCCAAATATGTATGAAAGCAACCCTGTGACACCAGCGTCTTCTTCAGCTCCTCCC
  AGATGCAACAACTACTCAGCTAATGCCCCTAAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001164470
• ORF Size: 666 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001164470.1, NP_001157942.1
• RefSeq Size: 1044
• RefSeq ORF: 666
• Locus ID: 54860
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene is a cell surface protein found primarily in the apical membrane of colonocytes. Silencing of this gene in colon cancer cells inhibits the proliferation, cell motility, and chemotactic invasion of cells. This gene is part of a cluster of similar genes found on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.