Endomucin (EMCN) (NM_001159694) Human Untagged Clone

CAT#: SC326814

EMCN (untagged)-Human endomucin (EMCN) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EMCN
• Synonyms: EMCN2; MUC14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001159694, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACTGCTTCAAGTGACCATTCTTTTTCTTCTGCCCAGTATTTGCAGCAGTAACAGCACAGGTGTTT
  TAGAGGCAGCTAATAATTCACTTGTTGTTACTACAACAAAACCATCTATAACAACACCAAACACAGAATC
  ATTACAGAAAAATGTTGTCACACCAACAACTGGAACAACTCCTAAAGGAACAATCACCAATGAATTACTT
  AAAATGTCTCTGATGTCAACAGCTACTTTTTTAACAAGTAAAGATGAAGGATTGAAAGCCACAACCACTG
  ATGTCAGGAAGAATGACTCCATCATTTCAAACGTAACAGTAACAAGTGTTACACTTCCAAATGCTGTTTC
  AACATTACAAAGTTCCAAACCCAAGAGTAGTGTTCTACAACCAGATGCATCACCTTCTAAAACTGGTACA
  TTAACCTCAATACCAGTTACAATTCCAGAAAACACCTCACAGTCTCAAGTAATAGGCACTGAGGGTGGAA
  AAAATGCAAGCACTTCAGCAACCAGCCGGTCTTATTCCAGTATTATTTTGCCGGTGGTTATTGCTTTGAT
  TGTAATAACACTTTCAGTATTTGTTCTGGTGGGTTTGTACCGAATGTGCTGGAAGGCAGATCCGGGCACA
  CCAGAAAATGGAAATGATCAACCTCAGTCTGATAAAGAGAGCGTGAAGCTTCTTACCGTTAAGACAATTT
  CTCATGAGTCTGGTGAGCACTCTGCACAAGGAAAAACCAAGAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001159694
• ORF Size: 747 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001159694.1, NP_001153166.1
• RefSeq Size: 4008
• RefSeq ORF: 747
• Locus ID: 51705
• Protein Families: Transmembrane
• Gene Summary: EMCN is a mucin-like sialoglycoprotein that interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix (Kinoshita et al., 2001 [PubMed 11418125]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) lacks an in-frame exon in the middle portion of the coding region compared to variant 1. This results in a shorter protein (isoform 2) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.