RDM1 (NM_001163130) Human Untagged Clone

CAT#: SC326833

RDM1 (untagged)-Human RAD52 motif 1 (RDM1) transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RDM1
• Synonyms: RAD52B
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001163130, the custom clone sequence may differ by one or more nucleotides
  ATGCATTTACTTGTCCCACCCCCACAGCATTCTCTGTTCACAGCATTTTCTCAGTTTGGC
  CTTCTGTATTCAGTCCGGGTCTTCCCAAATGCTGCAGTGGCCCATCCTGGTTTCTATGCC
  GTCATTAAGTTTTATTCTGCAAGGGCTGCCCACAGAGCCCAAAAGGCATGCGACCGGAAG
  CAGCTTTTTCAGAAATCTCCAGTCAAGGTTCGTCTTGGCACCAGACATAAGGCAGTTCAA
  CATCAAGCCCTTGCCCTGAACAGTTCCAAATGCCAAGAACTGGCGAATTACTACTTTGGT
  TTCAATGGGTGTTCCAAAAGGATCATCAAGCTTCAGGAGCTTTCTGACCTTGAAGAAAGG
  GAAAATGAAGATAGCATGGTGCCACTTCCGAAGCAAAGCCTGAAGTTCTTCTGTGCTTTA
  GAAGTGGTGTTGCCATCCTGTGATTGCAGGAGTCCTGGCATTGGCTTGGTGGAGGAGCCT
  ATGGATAAGGTGGAGGAAGGACCATTATCATTCCTTATGAAAAGGAAGACAGCCCAGAAG
  CTTGCTATTCAGAAGGCTTTGTCAGATGCATTCCAGAAACTGTTGATTGTTGTTCTAGAA
  AGTGGTAAAATAGCTGTGGAGTACAGACCCAGTGAAGACATCGTAGGTGTCAGATGCGAA
  GAAGAACTACACGGTTTAATTCAAGTCCCTTGCTCTCCCTGGAAGCAGTATGGCCAAGAG
  GAGGAAGGGTATCTCTCGGATTTCAGCTTGGAGGAGGAAGAGTTCAGGCTGCCAGAACTT
  GAC
  
• Restriction Sites: Please inquire
• ACCN: NM_001163130
• ORF Size: 786 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001163130.1, NP_001156602.1
• RefSeq Size: 1065
• RefSeq ORF: 786
• Locus ID: 201299
• Gene Summary: This gene encodes a protein involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. The protein encoded by this gene contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. The RAD52 motif region in RAD52 is important for protein function and may be involved in DNA binding or oligomerization. Alternatively spliced transcript variants encoding different isoforms have been reported. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (8) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (8, also known as DeltaN-alpha) has a shorter and distinct N-terminus compared to isoform 1.