PDHX (NM_001166158) Human Untagged Clone
CAT#: SC326840
PDHX (untagged)-Human pyruvate dehydrogenase complex component X (PDHX) nuclear gene encoding mitochondrial protein transcript variant 3
"NM_001166158" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PDHX |
Synonyms | DLDBP; E3BP; OPDX; PDHXD; PDX1; proX |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001166158, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCTCCTGGAGGCTGGGCTGTGATCCGCGGCTGCTGCGTTATCTTGTGGGCTTCCCCGGCCGCC GAAGCGTAGGGCTGGTGAAGGGGGCTCTTGGGTGGTCTGTAAGCCGCGGAGCTAATTGGAGATGGTTTCA CAGCACGCAGTGGCTTCGGGGTGATCCCATTAAGATACTAATGCCATCACTGTCTCCTACAATGGAAGAA GGAAACATTGTGAAATGGCTGAAAAAGGAAGGTGAAGCGGTGAGTGCTGGAGATGCATTATGTGAAATTG AGACTGACAAAGCTGTGGTTACCTTAGATGCAAGTGATGATGGAATCTTGGCCAAAATCGTGCAAATGCC AGATGTTAATGTAAGCTGGGATGGAGAGGGCCCAAAGCAACTGCCATTTATTGACATTTCAGTGGCTGTG GCAACAGATAAAGGCTTACTTACTCCAATCATAAAAGATGCTGCTGCTAAAGGTATCCAGGAAATTGCTG ACTCTGTAAAGGCTCTATCAAAGAAAGCAAGAGATGGAAAATTGTTGCCTGAAGAATACCAAGGAGGATC TTTTAGTATTTCCAACTTGGGGATGTTTGGCATCGACGAATTTACTGCAGTGATTAACCCTCCTCAGGCC TGCATTTTGGCGGTTGGGAGGTTCCGACCTGTGCTGAAGCTCACTGAGGATGAAGAGGGAAATGCCAAAC TGCAGCAGCGCCAGCTCATAACAGTCACAATGTCAAGTGACAGTCGAGTGGTTGATGACGAACTGGCAAC CAGGTTTCTTAAAAGTTTTAAAGCAAACCTAGAGAATCCTATCCGACTTGCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166158 |
ORF Size | 825 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001166158.1, NP_001159630.1 |
RefSeq Size | 2310 |
RefSeq ORF | 825 |
Locus ID | 8050 |
Gene Summary | The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (3) lacks multiple in-frame exons in the central coding region, compared to variant 1, resulting in a protein (isoform 3) that lacks 227 aa, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228205 | PDHX (Myc-DDK-tagged)-Human pyruvate dehydrogenase complex, component X (PDHX), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 420.00 |
|
RG228205 | PDHX (GFP-tagged) - Human pyruvate dehydrogenase complex, component X (PDHX), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 460.00 |
|
RC228205L3 | Lenti ORF clone of Human pyruvate dehydrogenase complex, component X (PDHX), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC228205L4 | Lenti ORF clone of Human pyruvate dehydrogenase complex, component X (PDHX), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review