NEK6 (NM_001166167) Human Untagged Clone

CAT#: SC326899

NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6) transcript variant 3


  "NM_001166167" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NEK6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NEK6
Synonyms SID6-1512
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166167, the custom clone sequence may differ by one or more nucleotides


ATGGGGAGACGCCGGCCTGCGCCCTTTCGTGCCCTCGTGAGGCTGGCATGCAGGATGGCAGGACAGCCCG
GCCACATGCCCCATGGAGGGAGTTCCAACAACCTCTGCCACACCCTGGGGCCTGTGCATCCTCCTGACCC
ACAGAGGCATCCCAACACGCTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAGATCGAAAAGAAGATAGGC
CGAGGACAGTTCAGCGAGGTGTACAAGGCCACCTGCCTGCTGGACAGGAAGACAGTGGCTCTGAAGAAGG
TGCAGATCTTTGAGATGATGGACGCCAAGGCGAGGCAGGACTGTGTCAAGGAGATCGGCCTCTTGAAGCA
ACTGAACCACCCAAATATCATCAAGTATTTGGACTCGTTTATCGAAGACAACGAGCTGAACATTGTGCTG
GAGTTGGCTGACGCAGGGGACCTCTCGCAGATGATCAAGTACTTTAAGAAGCAGAAGCGGCTCATCCCGG
AGAGGACAGTATGGAAGTACTTTGTGCAGCTGTGCAGCGCCGTGGAGCACATGCATTCACGCCGGGTGAT
GCACCGAGACATCAAGCCTGCCAACGTGTTCATCACAGCCACGGGCGTCGTGAAGCTCGGTGACCTTGGT
CTGGGCCGCTTCTTCAGCTCTGAGACCACCGCAGCCCACTCCCTAGTGGGGACGCCCTACTACATGTCAC
CGGAGAGGATCCATGAGAACGGCTACAACTTCAAGTCCGACATCTGGTCCCTGGGCTGTCTGCTGTACGA
GATGGCAGCCCTCCAGAGCCCCTTCTATGGAGATAAGATGAATCTCTTCTCCCTGTGCCAGAAGATCGAG
CAGTGTGACTACCCCCCACTCCCCGGGGAGCACTACTCCGAGAAGTTACGAGAACTGGTCAGCATGTGCA
TCTGCCCTGACCCCCACCAGAGACCTGACATCGGATACGTGCACCAGGTGGCCAAGCAGATGCACATCTG
GATGTCCAGCACCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001166167
ORF Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166167.1, NP_001159639.1
RefSeq Size 2592
RefSeq ORF 996
Locus ID 10783
Protein Families Druggable Genome, Protein Kinase
Gene Summary The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.