NEK6 (NM_001166167) Human Untagged Clone
CAT#: SC326899
NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6) transcript variant 3
"NM_001166167" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NEK6 |
Synonyms | SID6-1512 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001166167, the custom clone sequence may differ by one or more nucleotides
ATGGGGAGACGCCGGCCTGCGCCCTTTCGTGCCCTCGTGAGGCTGGCATGCAGGATGGCAGGACAGCCCG GCCACATGCCCCATGGAGGGAGTTCCAACAACCTCTGCCACACCCTGGGGCCTGTGCATCCTCCTGACCC ACAGAGGCATCCCAACACGCTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAGATCGAAAAGAAGATAGGC CGAGGACAGTTCAGCGAGGTGTACAAGGCCACCTGCCTGCTGGACAGGAAGACAGTGGCTCTGAAGAAGG TGCAGATCTTTGAGATGATGGACGCCAAGGCGAGGCAGGACTGTGTCAAGGAGATCGGCCTCTTGAAGCA ACTGAACCACCCAAATATCATCAAGTATTTGGACTCGTTTATCGAAGACAACGAGCTGAACATTGTGCTG GAGTTGGCTGACGCAGGGGACCTCTCGCAGATGATCAAGTACTTTAAGAAGCAGAAGCGGCTCATCCCGG AGAGGACAGTATGGAAGTACTTTGTGCAGCTGTGCAGCGCCGTGGAGCACATGCATTCACGCCGGGTGAT GCACCGAGACATCAAGCCTGCCAACGTGTTCATCACAGCCACGGGCGTCGTGAAGCTCGGTGACCTTGGT CTGGGCCGCTTCTTCAGCTCTGAGACCACCGCAGCCCACTCCCTAGTGGGGACGCCCTACTACATGTCAC CGGAGAGGATCCATGAGAACGGCTACAACTTCAAGTCCGACATCTGGTCCCTGGGCTGTCTGCTGTACGA GATGGCAGCCCTCCAGAGCCCCTTCTATGGAGATAAGATGAATCTCTTCTCCCTGTGCCAGAAGATCGAG CAGTGTGACTACCCCCCACTCCCCGGGGAGCACTACTCCGAGAAGTTACGAGAACTGGTCAGCATGTGCA TCTGCCCTGACCCCCACCAGAGACCTGACATCGGATACGTGCACCAGGTGGCCAAGCAGATGCACATCTG GATGTCCAGCACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166167 |
ORF Size | 996 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001166167.1, NP_001159639.1 |
RefSeq Size | 2592 |
RefSeq ORF | 996 |
Locus ID | 10783 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228264 | NEK6 (Myc-DDK-tagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 3 |
USD 420.00 |
|
RG228264 | NEK6 (GFP-tagged) - Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 3 |
USD 460.00 |
|
RC228264L3 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC228264L4 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review