FCRL1 (NM_001159397) Human Untagged Clone
CAT#: SC326929
FCRL1 (untagged)-Human Fc receptor-like 1 (FCRL1) transcript variant 2
"NM_001159397" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FCRL1 |
Synonyms | CD307a; FCRH1; IFGP1; IRTA5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001159397, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCGAGGCTGTTGCTGTTGATCTGTGCTCCACTCTGTGAACCTGCCGAGCTGTTTTTGATAGCCA GCCCCTCCCATCCCACAGAGGGGAGCCCAGTGACCCTGACGTGTAAGATGCCCTTTCTACAGAGTTCAGA TGCCCAGTTCCAGTTCTGCTTTTTCAGAGACACCCGGGCCTTGGGCCCAGGCTGGAGCAGCTCCCCCAAG CTCCAGATCGCTGCCATGTGGAAAGAAGACACAGGGTCATACTGGTGCGAGGCACAGACAATGGCGTCCA AAGTCTTGAGGAGCAGGAGATCCCAGATAAATGTGCACAGGGTCCCTGTCGCTGATGTGAGCTTGGAGAC TCAGCCCCCAGGAGGACAGGTGATGGAGGGAGACAGGCTGGTCCTCATCTGCTCAGTTGCTATGGGCACA GGAGACATCACCTTCCTTTGGTACAAAGGGGCTGTAGGTTTAAACCTTCAGTCAAAGACCCAGCGTTCAC TGACAGCAGAGTATGAGATTCCTTCAGTGAGGGAGAGTGATGCTGAGCAATATTACTGTGTAGCTGAAAA TGGCTATGGTCCCAGCCCCAGTGGGCTGGTGAGCATCACTGTCAGAATCCCGGTGTCTCGCCCAATCCTC ATGCTCAGGGCTCCCAGGGCCCAGGCTGCAGTGGAGGATGTGCTGGAGCTTCACTGTGAGGCCCTGAGAG GCTCTCCTCCGATCCTGTACTGGTTTTATCACGAGGATATCACCCTGGGGAGCAGGTCGGCCCCCTCTGG AGGAGGAGCCTCCTTCAACCTTTCCCTGACTGAAGAACATTCTGGAAACTACTCCTGTGAGGCCAACAAT GGCCTGGGGGCCCAGCGCAGTGAGGCGGTGACACTCAACTTCACAGGAAGACGTTCAGCCAGGGATCCAC TCAGGAGCCTTCCCAGCCCTCTACCCCAAGAGTTCACCTACCTCAACTCACCTACCCCAGGGCAGCTACA GCCTATATATGAAAATGAACCAAGAGAACAATCAGTGGCTGTGCATGGCAGACAACAGCATTCCTCAGAG CAGAAGGCTCAGAAACCCTGGGGACACATATGGAGGACAAGGTTTCCTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159397 |
ORF Size | 1101 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001159397.1, NP_001152869.1 |
RefSeq Size | 2989 |
RefSeq ORF | 1101 |
Locus ID | 115350 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (2) uses an alternate exon in the 3' coding region compared to variant 1, that results in a frameshift. This variant encodes isoform 2, which is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228294 | FCRL1 (Myc-DDK-tagged)-Human Fc receptor-like 1 (FCRL1), transcript variant 2 |
USD 420.00 |
|
RG228294 | FCRL1 (GFP-tagged) - Human Fc receptor-like 1 (FCRL1), transcript variant 2 |
USD 460.00 |
|
RC228294L1 | Lenti ORF clone of Human Fc receptor-like 1 (FCRL1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC228294L2 | Lenti ORF clone of Human Fc receptor-like 1 (FCRL1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC228294L3 | Lenti ORF clone of Human Fc receptor-like 1 (FCRL1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228294L4 | Lenti ORF clone of Human Fc receptor-like 1 (FCRL1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review