FCRL1 (NM_001159397) Human Untagged Clone

CAT#: SC326929

FCRL1 (untagged)-Human Fc receptor-like 1 (FCRL1) transcript variant 2


  "NM_001159397" in other vectors (6)

Reconstitution Protocol

USD 630.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FCRL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FCRL1
Synonyms CD307a; FCRH1; IFGP1; IRTA5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001159397, the custom clone sequence may differ by one or more nucleotides


ATGCTGCCGAGGCTGTTGCTGTTGATCTGTGCTCCACTCTGTGAACCTGCCGAGCTGTTTTTGATAGCCA
GCCCCTCCCATCCCACAGAGGGGAGCCCAGTGACCCTGACGTGTAAGATGCCCTTTCTACAGAGTTCAGA
TGCCCAGTTCCAGTTCTGCTTTTTCAGAGACACCCGGGCCTTGGGCCCAGGCTGGAGCAGCTCCCCCAAG
CTCCAGATCGCTGCCATGTGGAAAGAAGACACAGGGTCATACTGGTGCGAGGCACAGACAATGGCGTCCA
AAGTCTTGAGGAGCAGGAGATCCCAGATAAATGTGCACAGGGTCCCTGTCGCTGATGTGAGCTTGGAGAC
TCAGCCCCCAGGAGGACAGGTGATGGAGGGAGACAGGCTGGTCCTCATCTGCTCAGTTGCTATGGGCACA
GGAGACATCACCTTCCTTTGGTACAAAGGGGCTGTAGGTTTAAACCTTCAGTCAAAGACCCAGCGTTCAC
TGACAGCAGAGTATGAGATTCCTTCAGTGAGGGAGAGTGATGCTGAGCAATATTACTGTGTAGCTGAAAA
TGGCTATGGTCCCAGCCCCAGTGGGCTGGTGAGCATCACTGTCAGAATCCCGGTGTCTCGCCCAATCCTC
ATGCTCAGGGCTCCCAGGGCCCAGGCTGCAGTGGAGGATGTGCTGGAGCTTCACTGTGAGGCCCTGAGAG
GCTCTCCTCCGATCCTGTACTGGTTTTATCACGAGGATATCACCCTGGGGAGCAGGTCGGCCCCCTCTGG
AGGAGGAGCCTCCTTCAACCTTTCCCTGACTGAAGAACATTCTGGAAACTACTCCTGTGAGGCCAACAAT
GGCCTGGGGGCCCAGCGCAGTGAGGCGGTGACACTCAACTTCACAGGAAGACGTTCAGCCAGGGATCCAC
TCAGGAGCCTTCCCAGCCCTCTACCCCAAGAGTTCACCTACCTCAACTCACCTACCCCAGGGCAGCTACA
GCCTATATATGAAAATGAACCAAGAGAACAATCAGTGGCTGTGCATGGCAGACAACAGCATTCCTCAGAG
CAGAAGGCTCAGAAACCCTGGGGACACATATGGAGGACAAGGTTTCCTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001159397
ORF Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001159397.1, NP_001152869.1
RefSeq Size 2989
RefSeq ORF 1101
Locus ID 115350
Protein Families Transmembrane
Gene Summary This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Transcript Variant: This variant (2) uses an alternate exon in the 3' coding region compared to variant 1, that results in a frameshift. This variant encodes isoform 2, which is shorter and has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.