PPP2R5C (NM_001161726) Human Untagged Clone

CAT#: SC327071

PPP2R5C (untagged)-Human protein phosphatase 2 regulatory subunit B' gamma isoform (PPP2R5C) transcript variant 6


  "NM_001161726" in other vectors (4)

Reconstitution Protocol

USD 910.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPP2R5C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPP2R5C
Synonyms B56G; B56gamma; PR61G
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001161726, the custom clone sequence may differ by one or more nucleotides


ATGCCGAATAAAAACAAGAAGGAGAAAGAATCACCAAAAGCAGGGAAGAGTGGAAAAAGTTCAAAAGAAG
GACAAGACACAGTAGAATCAGAGCAAATTTCCGTCAGGAAAAACAGCCTTGTTGCTGTCCCGTCTACAGT
ATCTGCTAAAATAAAAGTACCAGTCTCTCAGCCCATAGTGAAGAAAGACAAACGGCAAAATTCTTCAAGG
TTTAGCGCAAGCAATAATAGAGAACTTCAAAAACTACCATCCTTAAAAGATGTTCCTCCTGCTGATCAAG
AGAAGCTTTTTATCCAGAAGTTACGTCAGTGTTGCGTCCTCTTTGACTTTGTTTCTGATCCACTAAGTGA
CCTAAAGTGGAAGGAAGTAAAACGAGCTGCTTTAAGTGAAATGGTAGAATATATCACCCATAATCGGAAT
GTGATCACAGAGCCTATTTACCCAGAAGTAGTCCATATGTTTGCAGTTAACATGTTTCGAACATTACCAC
CTTCCTCCAATCCTACGGGAGCGGAATTTGACCCGGAGGAAGATGAACCAACGTTAGAAGCAGCCTGGCC
TCATCTACAGCTTGTTTATGAATTTTTCTTAAGATTTTTAGAGTCTCCAGATTTCCAACCTAATATAGCG
AAGAAATATATTGATCAGAAGTTTGTATTGCAGCTTTTAGAGCTCTTTGACAGTGAAGATCCTCGGGAGA
GAGATTTTCTTAAAACCACCCTTCACAGAATCTATGGGAAATTCCTAGGCTTGAGAGCTTACATCAGAAA
ACAGATAAATAATATATTTTATAGGTTTATTTATGAAACAGAGCATCATAATGGCATAGCAGAGTTACTG
GAAATATTGGGAAGTATAATTAATGGATTTGCCTTACCACTAAAAGAAGAGCACAAGATTTTCTTATTGA
AGGTGTTACTACCTTTGCACAAAGTGAAATCTCTGAGTGTCTACCATCCCCAGCTGGCATACTGTGTAGT
GCAGTTTTTAGAAAAGGACAGCACCCTCACGGAACCAGTGGTGATGGCACTTCTCAAATACTGGCCAAAG
ACTCACAGTCCAAAAGAAGTAATGTTCTTAAACGAATTAGAAGAGATTTTAGATGTCATTGAACCATCAG
AATTTGTGAAGATCATGGAACCCCTCTTCCGGCAGTTGGCCAAATGTGTCTCCAGCCCACACTTCCAGGT
GGCAGAGCGAGCTCTCTATTACTGGAATAATGAATACATCATGAGTTTAATCAGTGACAACGCAGCGAAG
ATTCTGCCCATCATGTTTCCTTCCTTGTACCGCAACTCAAAGACCCATTGGAACAAGACAATACATGGCT
TGATATACAACGCCCTGAAGCTCTTCATGGAGATGAACCAAAAGCTATTTGATGACTGTACACAACAGTT
CAAAGCAGAGAAACTAAAAGAGAAGCTAAAAATGAAAGAACGGGAAGAAGCATGGGTTAAAATAGAAAAT
CTAGCCAAAGCCAATCCCCAGGCACAGAAAGATCCGAAGAAGGACCGTCCTCTTGCACGCCGCAAGTCCG
AGCTGCCTCAGGACCCCCACACCAAGAAAGCCTTGGAAGCTCACTGCAGGGCCGATGAGCTGGCCTCCCA
GGACGGCCGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001161726
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001161726.1, NP_001155198.1
RefSeq Size 4449 bp
RefSeq ORF 1623 bp
Locus ID 5527
Cytogenetics 14q32.31
Protein Families Druggable Genome, Phosphatase
Protein Pathways Oocyte meiosis, Wnt signaling pathway
Gene Summary 'The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also lacks an in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (f) has a distinct N-terminus and is longer than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.