SCOC (NM_001153585) Human Untagged Clone

CAT#: SC327366

SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCOC
• Synonyms: HRIHFB2072; SCOCO; UNC-69
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001153585, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACGGGTCCAGGAAAGAGGAGGAGGAAGACAGCACATTCACCAACATTTCTCTTGCAGATGACATAG
  ACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAATGCTGACATGGA
  TGCAGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTTATTAATCAAGTGTTGGAACTC
  CAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCAGTTAAGGAAGAAAATCTGAAGCTAAAATCAG
  AAAACCAAGTTCTTGGACAATATATAGAAAATCTCATGTCAGCTTCTAGTGTTTTTCAAACAACTGACAC
  AAAAAGCAAAAGAAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001153585
• ORF Size: 369 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001153585.1, NP_001147057.1
• RefSeq Size: 2009
• RefSeq ORF: 369
• Locus ID: 60592
• Gene Summary: This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
  Transcript Variant: This variant (5) differs in the 5' UTR and 5' coding region, compared to variant 1, resulting in an isoform (4) with a distinct and shorter N-terminus, compared to isoform 1. Variants 4, 5 and 6 encode the same isoform.