SCOC (NM_001153585) Human Untagged Clone
CAT#: SC327366
SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 5
"NM_001153585" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SCOC |
Synonyms | HRIHFB2072; SCOCO; UNC-69 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001153585, the custom clone sequence may differ by one or more nucleotides
ATGGACGGGTCCAGGAAAGAGGAGGAGGAAGACAGCACATTCACCAACATTTCTCTTGCAGATGACATAG ACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAATGCTGACATGGA TGCAGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTTATTAATCAAGTGTTGGAACTC CAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCAGTTAAGGAAGAAAATCTGAAGCTAAAATCAG AAAACCAAGTTCTTGGACAATATATAGAAAATCTCATGTCAGCTTCTAGTGTTTTTCAAACAACTGACAC AAAAAGCAAAAGAAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001153585 |
ORF Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001153585.1, NP_001147057.1 |
RefSeq Size | 2009 |
RefSeq ORF | 369 |
Locus ID | 60592 |
Gene Summary | This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (5) differs in the 5' UTR and 5' coding region, compared to variant 1, resulting in an isoform (4) with a distinct and shorter N-terminus, compared to isoform 1. Variants 4, 5 and 6 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228731 | SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 5 |
USD 420.00 |
|
RG228731 | SCOC (GFP-tagged) - Human short coiled-coil protein (SCOC), transcript variant 5 |
USD 460.00 |
|
RC228731L3 | Lenti ORF clone of Human short coiled-coil protein (SCOC), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC228731L4 | Lenti ORF clone of Human short coiled-coil protein (SCOC), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review