SSX2 (SSX2B) (NM_001164417) Human Untagged Clone

CAT#: SC327386

SSX2B (untagged)-Human synovial sarcoma X breakpoint 2B (SSX2B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SSX2B
• Synonyms: CT5.2; CT5.2b; HOM-MEL-40; SSX
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164417, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACGGAGACGACGCCTTTGCAAGGAGACCCACGGTTGGTGCTCAAATACCAGAGAAGATCCAAAAGG
  CCTTCGATGATATTGCCAAATACTTCTCTAAGGAAGAGTGGGAAAAGATGAAAGCCTCGGAGAAAATCTT
  CTATGTGTATATGAAGAGAAAGTATGAGGCTATGACTAAACTAGGTTTCAAGGCCACCCTCCCACCTTTC
  ATGTGTAATAAACGGGCCGAAGACTTCCAGGGGAATGATTTGGATAATGACCCTAACCGTGGGAATCAGG
  TTGAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTCCCCGAAGATCATGCCCAAGAAGCCAGC
  AGAGGAAGGAAATGATTCGGAGGAAGTGCCAGAAGCATCTGGCCCACAAAATGATGGGAAAGAGCTGTGC
  CCCCCGGGAAAACCAACTACCTCTGAGAAGATTCACGAGAGATCTGGACCCAAAAGGGGGGAACATGCCT
  GGACCCACAGACTGCGTGAGAGAAAACAGCTGGTGATTTATGAAGAGATCAGCGACCCTGAGGAAGATGA
  CGAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001164417
• ORF Size: 567 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001164417.2, NP_001157889.1
• RefSeq Size: 1347
• RefSeq ORF: 567
• Locus ID: 727837
• Gene Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. This gene, and also the SSX1 and SSX4 family members, have been involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. The encoded hybrid proteins are likely responsible for transforming activity. Alternative splicing of this gene results in multiple transcript variants. This gene also has an identical duplicate, GeneID: 6757, located about 45 kb upstream in the opposite orientation on chromosome X. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) lacks an alternate exon which results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) contains a shorter and distinct C-terminus, compared to isoform a.