HOXD9 (NM_014213) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HOXD9 |
Synonyms | Hox-4.3; Hox-5.2; HOX4; HOX4C |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_014213, the custom clone sequence may differ by one or more nucleotides
ATGTTGGGTGGGAGTGCGGGACGCCTCAAAATGTCTTCCAGTGGCACCCTCAGCAACTAC TACGTGGACTCGCTTATAGGCCATGAGGGCGACGAGGTGTTCGCGGCGCGCTTCGGGCCG CCGGGGCCAGGCGCGCAGGGCCGGCCTGCAGGTGTGGCTGATGGCCCGGCCGCCACCGCC GCCGAGTTCGCCTCGTGTAGTTTTGCCCCCAGATCGGCCGTGTTCTCTGCCTCGTGGTCC GCGGTGCCCTCCCAGCCCCCGGCAGCGGCGGCGATGAGCGGCCTCTACCACCCGTACGTT CCCCCGCCGCCCCTGGCCGCCTCTGCCTCCGAGCCCGGCCGCTACGTGCGCTCCTGGATG GAGCCGCTGCCCGGCTTCCCGGGCGGTGCGGGCGGTGGCGGTGGTGGTGGAGGCGGCGGT CCGGGCCGCGGTCCCAGCCCTGGCCCCAGCGGCCCAGCCAACGGGCGCCACTACGGGATT AAGCCTGAAACCCGAGCGGCCCCGGCCCCCGCCACGGCCGCCTCCACCACCTCCTCCTCC TCCACTTCCTTATCCTCCTCCTCCAAACGGACTGAGTGCTCCGTGGCCCGGGAGTCCCAG GGGAGCAGCGGCCCCGAGTTCTCGTGCAACTCGTTCCTGCAGGAGAAGGCGGCAGCGGCG ACGGGGGGAACCGGGCCTGGGGCAGGGATCGGGGCCGCGACTGGGACGGGCGGCTCGTCG GAGCCCTCAGCTTGCAGCGACCACCCGATCCCAGGCTGTTCGCTGAAGGAGGAGGAGAAG CAGCATTCGCAGCCGCAGCAGCAGCAACTTGACCCAAACAACCCCGCCGCGAACTGGATC CACGCTCGCTCCACCCGGAAAAAGCGCTGTCCCTACACCAAATACCAGACGCTTGAGCTG GAGAAAGAATTCCTCTTCAACATGTACCTCACCCGGGACCGGCGCTACGAGGTGGCCAGG ATTCTCAACCTAACAGAGAGACAGGTCAAAATCTGGTTTCAGAACCGTAGGATGAAAATG AAAAAGATGAGCAAGGAGAAATGCCCCAAAGGAGAC |
Restriction Sites | Please inquire |
ACCN | NM_014213 |
Insert Size | 1902 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014213.3, NP_055028.3 |
RefSeq Size | 1902 bp |
RefSeq ORF | 1902 bp |
Locus ID | 3235 |
Cytogenetics | 2q31.1 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC126053 | HOXD9 (untagged)-Human homeobox D9 (HOXD9) |
USD 310.00 |
|
RC206492 | HOXD9 (Myc-DDK-tagged)-Human homeobox D9 (HOXD9) |
USD 420.00 |
|
RG206492 | HOXD9 (GFP-tagged) - Human homeobox D9 (HOXD9) |
USD 460.00 |
|
RC206492L3 | Lenti-ORF clone of HOXD9 (Myc-DDK-tagged)-Human homeobox D9 (HOXD9) |
USD 620.00 |
|
RC206492L4 | Lenti-ORF clone of HOXD9 (mGFP-tagged)-Human homeobox D9 (HOXD9) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review