APOBEC3D (NM_152426) Human Untagged Clone
CAT#: SC327820
APOBEC3D (untagged)-Human apolipoprotein B mRNA editing enzyme catalytic polypeptide-like 3D (APOBEC3D)
"NM_152426" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | APOBEC3D |
Synonyms | A3D; APOBEC3DE; APOBEC3E; ARP6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_152426, the custom clone sequence may differ by one or more nucleotides
ATGAATCCACAGATCAGAAATCCGATGGAGCGGATGTATCGAGACACATTCTACGACAACTTTGAAAACG AACCCATCCTCTATGGTCGGAGCTACACTTGGCTGTGCTATGAAGTGAAAATAAAGAGGGGCCGCTCAAA TCTCCTTTGGGACACAGGGGTCTTTCGAGGCCCGGTACTACCCAAACGTCAGTCGAATCACAGGCAGGAG GTGTATTTCCGGTTTGAGAACCACGCAGAAATGTGCTTCTTATCTTGGTTCTGTGGCAACCGACTGCCTG CTAACAGGCGCTTCCAGATCACCTGGTTTGTATCATGGAACCCCTGCCTGCCCTGTGTGGTGAAGGTGAC CAAATTCTTGGCTGAGCACCCCAATGTCACCCTGACCATCTCTGCCGCCCGCCTCTACTACTACCGGGAT AGAGATTGGCGGTGGGTGCTCCTCAGGCTGCATAAGGCAGGGGCCCGTGTGAAGATCATGGACTATGAAG ACTTTGCATACTGCTGGGAAAACTTTGTGTGCAATGAAGGTCAGCCATTCATGCCTTGGTACAAATTCGA TGACAATTATGCATCCCTGCACCGCACGCTAAAGGAGATTCTCAGAAACCCGATGGAGGCAATGTACCCA CACATATTCTACTTCCACTTTAAAAACCTACTGAAAGCCTGTGGTCGGAACGAAAGCTGGCTGTGCTTCA CCATGGAAGTTACAAAGCACCACTCAGCTGTCTTCCGGAAGAGGGGCGTCTTCCGAAACCAGGTGGATCC TGAGACCCATTGTCATGCAGAAAGGTGCTTCCTCTCTTGGTTCTGTGACGACATACTGTCTCCTAACACA AACTACGAGGTCACCTGGTACACATCTTGGAGCCCTTGCCCAGAGTGTGCAGGGGAGGTGGCCGAGTTCC TGGCCAGGCACAGCAACGTGAATCTCACCATCTTCACCGCCCGCCTCTGCTACTTCTGGGATACAGATTA CCAGGAGGGGCTCTGCAGCCTGAGTCAGGAAGGGGCCTCCGTGAAGATCATGGGCTACAAAGATTTTGTA TCTTGTTGGAAAAACTTTGTGTACAGTGATGATGAGCCATTCAAGCCTTGGAAGGGACTACAAACCAACT TTCGACTTCTGAAAAGAAGGCTACGGGAGATTCTCCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_152426 |
ORF Size | 1161 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_152426.3, NP_689639.2 |
RefSeq Size | 2519 |
RefSeq ORF | 1161 |
Locus ID | 140564 |
Gene Summary | This gene is a member of the cytidine deaminase gene family. It is one of a group of related genes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1 and inhibit retroviruses, such as HIV, by deaminating cytosine residues in nascent retroviral cDNA. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC306395 | APOBEC3D (untagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (APOBEC3D) |
USD 660.00 |
|
RC229185 | APOBEC3D (Myc-DDK-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (APOBEC3D) |
USD 420.00 |
|
RG229185 | APOBEC3D (GFP-tagged) - Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (APOBEC3D) |
USD 460.00 |
|
RC229185L1 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (APOBEC3D), Myc-DDK-tagged |
USD 768.00 |
|
RC229185L2 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (APOBEC3D), mGFP tagged |
USD 620.00 |
|
RC229185L3 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (APOBEC3D), Myc-DDK-tagged |
USD 620.00 |
|
RC229185L4 | Lenti ORF clone of Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (APOBEC3D), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review