HOXA10 (NM_018951) Human Untagged Clone

CAT#: SC327835

HOXA10 (untagged)-Human homeobox A10 (HOXA10) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HOXA10
• Synonyms: HOX1; HOX1.8; HOX1H; PL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_018951, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCAGCCAGAAAGGGCTATCTGCTCCCTTCGCCAAATTATCCCACAACAATGTCATGCTCGGAGAGCC
  CCGCCGCGAACTCTTTTTTGGTCGACTCGCTCATCAGCTCGGGCAGAGGCGAGGCAGGCGGCGGTGGTGG
  TGGCGCGGGGGGCGGCGGCGGTGGCGGTTACTACGCCCACGGCGGGGTCTACCTGCCGCCCGCCGCCGAC
  CTGCCCTACGGGCTGCAGAGCTGCGGGCTCTTCCCCACGCTGGGCGGCAAGCGCAATGAGGCAGCGTCGC
  CGGGCAGCGGTGGCGGTGGCGGGGGTCTAGGTCCCGGGGCGCACGGCTACGGGCCCTCGCCCATAGACCT
  GTGGCTAGACGCGCCCCGGTCTTGCCGGATGGAGCCGCCTGACGGGCCGCCGCCGCCGCCCCAGCAGCAG
  CCGCCGCCCCCGCCGCAACCACCCCAGCCAGCGCCGCAGGCCACCTCGTGCTCTTTCGCGCAGAACATCA
  AAGAAGAGAGCTCCTACTGCCTCTACGACTCGGCGGACAAATGCCCCAAAGTCTCGGCCACCGCCGCCGA
  ACTGGCTCCCTTCCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCACCTCCAGCGGGGTGCCAGTG
  CCTGGCTACTTCCGCCTTTCTCAGGCCTACGGCACCGCCAAGGGCTATGGCAGCGGCGGCGGCGGCGCGC
  AGCAACTCGGGGCTGGCCCGTTCCCCGCGCAGCCCCCGGGGCGCGGTTTCGATCTCCCGCCCGCGCTAGC
  CTCCGGCTCGGCCGATGCGGCCCGGAAGGAGCGAGCCCTCGATTCGCCGCCGCCCCCCACGCTGGCTTGC
  GGCAGCGGCGGGGGCTCGCAGGGCGACGAGGAGGCGCACGCGTCGTCCTCGGCCGCGGAGGAGCTCTCCC
  CGGCCCCTTCCGAGAGCAGCAAAGCCTCGCCGGAGAAGGATTCCCTGGGCAATTCCAAAGGTGAAAACGC
  AGCCAACTGGCTCACGGCAAAGAGTGGTCGGAAGAAGCGCTGCCCCTACACGAAGCACCAGACACTGGAG
  CTGGAGAAGGAGTTTCTGTTCAATATGTACCTTACTCGAGAGCGGCGCCTAGAGATTAGCCGCAGCGTCC
  ACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAACTGAAGAAAATGAATCGAGA
  AAACCGGATCCGGGAGCTCACAGCCAACTTTAATTTTTCCTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_018951
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_018951.3, NP_061824.3
• RefSeq Size: 2648 bp
• RefSeq ORF: 1233 bp
• Locus ID: 3206
• Cytogenetics: 7p15.2
• Protein Families: Transcription Factors
• Gene Summary: 'In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor that may regulate gene expression, morphogenesis, and differentiation. More specifically, it may function in fertility, embryo viability, and regulation of hematopoietic lineage commitment. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the downstream homeobox A9 (HOXA9) gene. [provided by RefSeq, Mar 2011]'
  Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Sequence Note: An upstream start codon is selected for this RefSeq based on conservation in at least 24 vertebrate species including mouse, rat, human, chimp, macaque, dog, cow, chicken, lizard, Xenopus tropicalis, Tetraodon and Fugu. Historically, a start codon that is 17 aa downstream has been used as the translation AUG start codon. No experimental evidence exists regarding which site is preferentially used.