IVD (NM_002225) Human Untagged Clone
CAT#: SC327852
IVD (untagged)-Human isovaleryl Coenzyme A dehydrogenase (IVD) nuclear gene encoding mitochondrial protein transcript variant 1
"NM_002225" in other vectors (13)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IVD |
Synonyms | ACAD2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002225, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAGATGGCGACTGCGACTCGGCTGCTGGGGTGGCGTGTGGCGAGCTGGAGGCTGCGGCCGCCGC TTGCCGGCTTCGTTTCCCAGCGGGCCCACTCGCTTTTGCCCGTGGACGATGCAATCAATGGGCTAAGCGA GGAGCAGAGGCAGCTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAG ATCGATCGCAGCAATGAGTTCAAGAACCTGCGAGAATTTTGGAAGCAGCTGGGGAACCTGGGCGTATTGG GCATCACAGCCCCTGTTCAGTATGGCGGCTCCGGCCTGGGCTACCTGGAGCATGTGCTGGTGATGGAGGA GATATCCCGAGCTTCCGGAGCAGTGGGGCTCAGTTACGGTGCCCACTCCAACCTCTGCATCAACCAGCTT GTACGCAATGGGAATGAGGCCCAGAAAGAGAAGTATCTCCCGAAGCTGATCAGTGGTGAGTACATCGGAG CCCTGGCCATGAGTGAGCCCAATGCAGGCTCTGATGTTGTCTCTATGAAGCTCAAAGCGGAAAAGAAAGG AAATCACTACATCCTGAATGGCAACAAGTTCTGGATCACTAATGGCCCTGATGCTGACGTCCTGATTGTC TATGCCAAGACAGATCTGGCTGCTGTGCCAGCTTCTCGGGGCATCACAGCCTTCATTGTGGAGAAGGGTA TGCCTGGCTTTAGCACCTCTAAGAAGCTGGACAAGCTGGGGATGAGGGGCTCTAACACCTGTGAGCTAAT CTTTGAAGACTGCAAGATTCCTGCTGCCAACATCCTGGGCCATGAGAATAAGGGTGTCTACGTGCTGATG AGTGGGCTGGACCTGGAGCGGCTGGTGCTGGCCGGGGGGCCTCTTGGGCTCATGCAAGCGGTCCTGGACC ACACCATTCCCTACCTGCACGTGAGGGAAGCCTTTGGCCAGAAGATCGGCCACTTCCAGTTGATGCAGGG GAAGATGGCTGACATGTACACCCGCCTCATGGCGTGTCGGCAGTATGTCTACAATGTCGCCAAGGCCTGC GATGAGGGCCATTGCACTGCTAAGGACTGTGCAGGTGTGATTCTTTACTCAGCTGAGTGTGCCACACAGG TAGCCCTGGACGGCATTCAGTGTTTTGGTGGCAATGGCTACATCAATGACTTTCCCATGGGCCGCTTTCT TCGAGATGCCAAGCTGTATGAGATAGGGGCTGGGACCAGCGAGGTGAGGCGGCTGGTCATCGGCAGAGCC TTCAATGCAGACTTTCACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_002225 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002225.3, NP_002216.2 |
RefSeq Size | 4673 bp |
RefSeq ORF | 1281 bp |
Locus ID | 3712 |
Cytogenetics | 15q15.1 |
Domains | Acyl-CoA_dh, Acyl-CoA_dh_M, Acyl-CoA_dh_N |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Valine, leucine and isoleucine degradation |
Gene Summary | 'Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]' Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC319252 | IVD (untagged)-Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 720.00 |
|
RC201077 | IVD (Myc-DDK-tagged)-Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 420.00 |
|
RC229217 | IVD (Myc-DDK-tagged)-Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 420.00 |
|
RG201077 | IVD (GFP-tagged) - Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 460.00 |
|
RG229217 | IVD (GFP-tagged) - Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 460.00 |
|
RC201077L1 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC201077L2 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC201077L3 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC201077L4 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC229217L1 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC229217L2 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 768.00 |
|
RC229217L3 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC229217L4 | Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review