Cannabinoid Receptor I (CNR1) (NM_033181) Human Untagged Clone
CAT#: SC327858
CNR1 (untagged)-Human cannabinoid receptor 1 (brain) (CNR1) transcript variant 2
"NM_033181" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CNR1 |
Synonyms | CANN6; CB-R; CB1; CB1A; CB1K5; CB1R; CNR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_033181, the custom clone sequence may differ by one or more nucleotides
ATGAAGTCGATCCTAGATGGCCTTGCAGATACCACCTTCCGCACCATCACCACTGACCTCCTGGGAAGTC CCTTCCAAGAGAAGATGACTGCGGGAGACAACCCCCAGCTAGTCCCAGCAGACCAGGTGAACATTACAGA ATTTTACAACAAGTCTCTCTCGTCCTTCAAGGAGAATGAGGAGAACATCCAGTGTGGGGAGAACTTCATG GACATAGAGTGTTTCATGGTCCTGAACCCCAGCCAGCAGCTGGCCATTGCAGTCCTGTCCCTCACGCTGG GCACCTTCACGGTCCTGGAGAACCTCCTGGTGCTGTGCGTCATCCTCCACTCCCGCAGCCTCCGCTGCAG GCCTTCCTACCACTTCATCGGCAGCCTGGCGGTGGCAGACCTCCTGGGGAGTGTCATTTTTGTCTACAGC TTCATTGACTTCCACGTGTTCCACCGCAAAGATAGCCGCAACGTGTTTCTGTTCAAACTGGGTGGGGTCA CGGCCTCCTTCACTGCCTCCGTGGGCAGCCTGTTCCTCACAGCCATCGACAGGTACATATCCATTCACAG GCCCCTGGCCTATAAGAGGATTGTCACCAGGCCCAAGGCCGTGGTGGCGTTTTGCCTGATGTGGACCATA GCCATTGTGATCGCCGTGCTGCCTCTCCTGGGCTGGAACTGCGAGAAACTGCAATCTGTTTGCTCAGACA TTTTCCCACACATTGATGAAACCTACCTGATGTTCTGGATCGGGGTCACCAGCGTACTGCTTCTGTTCAT CGTGTATGCGTACATGTATATTCTCTGGAAGGCTCACAGCCACGCCGTCCGCATGATTCAGCGTGGCACC CAGAAGAGCATCATCATCCACACGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCA TGGACATTAGGTTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCT TGCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGT ATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGGAGTAAGGACCTGCGACACG CTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCATGGGGGACTCGGA CTGCCTGCACAAACACGCAAACAATGCAGCCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACG GTCAAGATTGCCAAGGTAACCATGTCTGTGTCCACAGACACGTCTGCCGAGGCTCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_033181 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033181.3, NP_149421.2 |
RefSeq Size | 5387 bp |
RefSeq ORF | 1320 bp |
Locus ID | 1268 |
Cytogenetics | 6q15 |
Domains | 7tm_1 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | 'This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]' Transcript Variant: This variant (2) lacks an internal segment near the 5' end of the coding region, compared to variant 1. The resulting protein (isoform b) has a shorter and distinct N-terminus compared to isoform a. PubMed ID: 15620723 referred to this variant and its protein as CB1b. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC127569 | CNR1 (untagged)-Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2 |
USD 740.00 |
|
RC218922 | CNR1 (Myc-DDK-tagged)-Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2 |
USD 420.00 |
|
RG218922 | CNR1 (GFP-tagged) - Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2 |
USD 460.00 |
|
RC218922L1 | Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC218922L2 | Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, mGFP tagged |
USD 768.00 |
|
RC218922L3 | Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC218922L4 | Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review