MBNL3 (NM_001170704) Human Untagged Clone

CAT#: SC328417

MBNL3 (untagged)-Human muscleblind-like 3 (Drosophila) (MBNL3) transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MBNL3
• Synonyms: CHCR; MBLX; MBLX39; MBXL
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001170704, the custom clone sequence may differ by one or more nucleotides
  ATGTTCGCCCAGCAGATGCAGCTTATGCTCCAAAACGCTCAAATGTCATCACTTGGTTCT
  TTTCCTATGACTCCATCAATTCCAGCTAATCCTCCCATGGCTTTCAATCCTTACATACCA
  CATCCTGGGATGGGCCTCGTTCCTGCAGAACTTGTACCAAATACACCTGTTCTGATTCCT
  GGAAACCCACCTCTTGCAATGCCAGGAGCTGTTGGCCCAAAACTGATGCGTTCAGATAAA
  CTGGAGGTTTGCCGAGAATTTCAGCGTGGAAATTGTACCCGTGGGGAGAATGATTGCCGC
  TATGCTCACCCTACTGATGCTTCCATGATTGAAGCGAGTGATAATACTGTGACAATCTGC
  ATGGATTACATCAAAGGTCGATGCTCGCGGGAGAAATGCAAGTACTTTCATCCTCCTGCA
  CACTTGCAAGCCAGACTCAAGGCAGCTCATCATCAGATGAACCATTCAGCTGCCTCTGCC
  ATGGCCCTGCAGCCTGGTACACTGCAACTGATACCAAAGAGATCAGCACTGGAAAAGCCC
  AATGGTGCCACCCCGGTCTTTAATCCCACTGTTTTCCACTGCCAACAGGCTCTGACTAAC
  CTGCAGCTCCCACAGCCGGCATTTATCCCTGCAGGGCCAATACTGTGCATGGCACCCGCT
  TCAAATATTGTGCCCATGATGCACGGTGCTACACCTACCACTGTGTCTGCAGCAACAACA
  CCTGCCACCAGCGTTCCGTTCGCTGCACCAACTACAGGCAATCAGCTGAAATTCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001170704
• ORF Size: 777 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001170704.1, NP_001164175.1
• RefSeq Size: 11539
• RefSeq ORF: 777
• Locus ID: 55796
• Gene Summary: This gene encodes a member of the muscleblind-like family of proteins. The encoded protein may function in regulation of alternative splicing and may play a role in the pathophysiology of myotonic dystrophy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (5) is shorter than isoform 1. Variants 5 and 6 encode the same isoform (5). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.