CFHR3 (NM_001166624) Human Untagged Clone
CAT#: SC328438
CFHR3 (untagged)-Human complement factor H-related 3 (CFHR3) transcript variant 2
"NM_001166624" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CFHR3 |
Synonyms | CFHL3; DOWN16; FHR-3; FHR3; HLF4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001166624, the custom clone sequence may differ by one or more nucleotides
ATGTTGTTACTAATCAATGTCATTCTGACCTTGTGGGTTTCCTGTGCTAATGGACAAGTGAAACCTTGTG ATTTTCCAGACATTAAACATGGAGGTCTATTTCATGAGAATATGCGTAGACCATACTTTCCAGTAGCTGT AGGAAAATATTACTCCTATTACTGTGATGAACATTTTGAGACTCCTTCAGGAAGTTACTGGGATTACATT CATTGCACACAAAATGGGTGGTCACCAGCAGTACCATGTCTCAGAAAATGTTATTTTCCTTATTTGGAAA ATGGATATAATCAAAATTATGGAAGAAAGTTTGTACAGGGTAACTCTACAGAAGTTGCCTGCCATCCTGG CTACGGTCTTCCAAAAGCGCAGACCACAGTTACATGTACGGAGAAAGGCTGGTCTCCTACTCCCAGATGC ATCCGTGTCAATTCTTCAGAAAAGTGTGGGCCTCCTCCACCTATTAGCAATGGTGATACCACCTCCTTTC TACTAAAAGTGTATGTGCCACAGTCAAGAGTCGAGTACCAATGCCAGCCCTACTATGAACTTCAGGGTTC TAATTATGTAACATGTAGTAATGGAGAGTGGTCGGAACCACCAAGATGCATACATCCATGTATAATAACT GAAGAAAACATGAATAAAAATAACATAAAGTTAAAAGGAAGAAGTGACAGAAAATATTATGCAAAAACAG GGGATACCATTGAATTTATGTGTAAATTGGGATATAATGCAAATACATCAATTCTATCATTTCAAGCAGT GTGTCGGGAAGGGATAGTGGAATACCCCAGATGCGAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166624 |
ORF Size | 810 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001166624.1, NP_001160096.1 |
RefSeq Size | 1484 |
RefSeq ORF | 810 |
Locus ID | 10878 |
Protein Families | Secreted Protein |
Gene Summary | The protein encoded by this gene is a secreted protein, which belongs to the complement factor H-related protein family. It binds to heparin, and may be involved in complement regulation. Mutations in this gene are associated with decreased risk of age-related macular degeneration, and with an increased risk of atypical hemolytic-uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) is missing an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) lacking an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229800 | CFHR3 (Myc-DDK-tagged)-Human complement factor H-related 3 (CFHR3), transcript variant 2 |
USD 420.00 |
|
RG229800 | CFHR3 (GFP-tagged) - Human complement factor H-related 3 (CFHR3), transcript variant 2 |
USD 460.00 |
|
RC229800L1 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC229800L2 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC229800L3 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229800L4 | Lenti ORF clone of Human complement factor H-related 3 (CFHR3), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review