CFHR3 (NM_001166624) Human Untagged Clone

CAT#: SC328438

CFHR3 (untagged)-Human complement factor H-related 3 (CFHR3) transcript variant 2


  "NM_001166624" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CFHR3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CFHR3
Synonyms CFHL3; DOWN16; FHR-3; FHR3; HLF4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166624, the custom clone sequence may differ by one or more nucleotides


ATGTTGTTACTAATCAATGTCATTCTGACCTTGTGGGTTTCCTGTGCTAATGGACAAGTGAAACCTTGTG
ATTTTCCAGACATTAAACATGGAGGTCTATTTCATGAGAATATGCGTAGACCATACTTTCCAGTAGCTGT
AGGAAAATATTACTCCTATTACTGTGATGAACATTTTGAGACTCCTTCAGGAAGTTACTGGGATTACATT
CATTGCACACAAAATGGGTGGTCACCAGCAGTACCATGTCTCAGAAAATGTTATTTTCCTTATTTGGAAA
ATGGATATAATCAAAATTATGGAAGAAAGTTTGTACAGGGTAACTCTACAGAAGTTGCCTGCCATCCTGG
CTACGGTCTTCCAAAAGCGCAGACCACAGTTACATGTACGGAGAAAGGCTGGTCTCCTACTCCCAGATGC
ATCCGTGTCAATTCTTCAGAAAAGTGTGGGCCTCCTCCACCTATTAGCAATGGTGATACCACCTCCTTTC
TACTAAAAGTGTATGTGCCACAGTCAAGAGTCGAGTACCAATGCCAGCCCTACTATGAACTTCAGGGTTC
TAATTATGTAACATGTAGTAATGGAGAGTGGTCGGAACCACCAAGATGCATACATCCATGTATAATAACT
GAAGAAAACATGAATAAAAATAACATAAAGTTAAAAGGAAGAAGTGACAGAAAATATTATGCAAAAACAG
GGGATACCATTGAATTTATGTGTAAATTGGGATATAATGCAAATACATCAATTCTATCATTTCAAGCAGT
GTGTCGGGAAGGGATAGTGGAATACCCCAGATGCGAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001166624
ORF Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166624.1, NP_001160096.1
RefSeq Size 1484
RefSeq ORF 810
Locus ID 10878
Protein Families Secreted Protein
Gene Summary The protein encoded by this gene is a secreted protein, which belongs to the complement factor H-related protein family. It binds to heparin, and may be involved in complement regulation. Mutations in this gene are associated with decreased risk of age-related macular degeneration, and with an increased risk of atypical hemolytic-uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) is missing an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) lacking an internal protein segment compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.