HDAC8 (NM_001166418) Human Untagged Clone

CAT#: SC328469

HDAC8 (untagged)-Human histone deacetylase 8 (HDAC8) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HDAC8
• Synonyms: CDA07; CDLS5; HD8; HDACL1; KDAC8; MRXS6; RPD3; WTS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166418, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGAGCCGGAGGAACCGGCGGACAGTGGGCAGTCGCTGGTCCCGGTTTATATCTATAGTCCCGAGT
  ATGTCAGTATGTGTGACTCCCTGGCCAAGATCCCCAAACGGGCCAGTATGGTGCATTCTTTGATTGAAGC
  ATATGCACTGCATAAGCAGATGAGAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTGGGA
  ATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCACCATGGAGATGGTG
  TAGAAGACGCATTCAGTTTCACCTCCAAAGTCATGACCGTGTCCCTGCACAAATTCTCCCCAGGATTTTT
  CCCAGGAACAGGTGACGTGTCTGATGTTGGCCTAGGGAAGGGACGGTACTACAGTGTAAATGTGCCCATT
  CAGGATGGCATACAAGATGAAAAATATTACCAGATCTGTGAAAGTGTACTAAAGGAAGTATACCAAGCCT
  TTAATCCCAAAGCAGTGGTCTTACAGCTGGGAGCTGACACAATAGCTGGGGATCCCATGTGCTCCTTTAA
  CATGACTCCAGTGGGAATTGGCAAGTGTCTTAAGTACATCCTTCAATGGCAGTTGGCAACACTCATTTTG
  GGAGGAGGAGGCTATAACCTTGCCAACACGGCTCGATGCTGGACATACTTGACCGGGGTCATCCTAGGGA
  AAACACTATCCTCTGAGATCCCAGATCATGAGTTTTTCACAGCATATGGTCCTGATTATGTGCTGGAAAT
  CACGCCAAGCTGCCGGCCAGACCGCAATGAGCCCCACCGAATCCAACAAATCCTCAACTACATCAAAGGG
  AATCTGAAGCATGTGGTCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166418
• ORF Size: 861 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001166418.1, NP_001159890.1
• RefSeq Size: 1791
• RefSeq ORF: 861
• Locus ID: 55869
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) lacks two alternate exons in the 5' coding region, compared to variant 1, resulting in a protein (isoform 2) that maintains the reading frame but is shorter, compared to isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on a strong Kozak signal and transcript support. An upstream in-frame start codon is also present but has a weaker Kozak signal and sparse transcript support. Use of the upstream start codon would result in a protein that is 38 aa longer at the N-terminus. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon, which is supported by 5'RACE experiments described in PubMed: 10922473 and encodes a protein with an N-terminus similar to other family members.