BHMT2 (NM_001178005) Human Untagged Clone

CAT#: SC328488

BHMT2 (untagged)-Human betaine--homocysteine S-methyltransferase 2 (BHMT2) transcript variant 2


  "NM_001178005" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BHMT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BHMT2
Synonyms FLJ20001
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001178005, the custom clone sequence may differ by one or more nucleotides


ATGGCACCTGCTGGACGCCCGGGGGCCAAGAAGGGGATTTTGGAGCGCCTGGAGAGTGGGGAGGTTGTGA
TTGGAGATGGCAGCTTTCTCATTACTCTGGAGAAGAGAGGCTATGTGAAGGCTGGGCTCTGGACTCCAGA
GGCAGTGATAGAACACCCAGACGCAGTTCGTCAACTTCACATGGAATTCTTGAGAGCAGGATCAAATGTC
ATGCAGACTTTTACCTTTTCTGCCAGTGAGGACAATATGGAAAGCAAGTATTTTGAGCACGTTGAAGAAG
CTGTGTGGGCTGTGGAAGTCTTAAAAGAATCAGATAGACCCGTGGCAGTTACCATGTGCATAGGCCCAGA
GGGAGACATGCATGATATAACCCCCGGAGAATGTGCTGTGAGGCTGGTGAAGGCAGGGGCTTCCATCGTT
GGCGTGAACTGCCGCTTTGGGCCCGACACCAGCTTGAAGACGATGGAGCTCATGAAGGAGGGTCTTGAGT
GGGCAGGGCTGAAAGCGCACCTCATGGTGCAGCCTCTGGGGTTCCACGCGCCTGACTGTGGCAAAGAGGG
GTTTGTGGATCTCCCAGAATATCCCTTTGGACTGGAGTCCAGAGTTGCCACCAGATGGGATATTCAAAAA
TACGCCAGAGAGGCCTACAACCTGGGGGTCAGGTACATTGGCGGGTGCTGTGGATTTGAGCCCTACCACA
TCAGGGCAATTGCAGAGGAGCTGGCCCCAGAAAGGGGCTTTTTGCCACCAGCTTCAGAAAAACACGGCAG
CTGGGGAAGTGGTTTGGACATGCACACCAAACCCTGGATTAGAGCAAGGGCTCGAAGGGAGTATTGGGAG
AATCTGCTGCCAGCTTCAGGCAGACCTTTCTGTCCTTCGCTGTCAAAGCCAGACTTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001178005
ORF Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001178005.1, NP_001171476.1
RefSeq Size 2459
RefSeq ORF 900
Locus ID 23743
Gene Summary Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.