BHMT2 (NM_001178005) Human Untagged Clone
CAT#: SC328488
BHMT2 (untagged)-Human betaine--homocysteine S-methyltransferase 2 (BHMT2) transcript variant 2
"NM_001178005" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BHMT2 |
Synonyms | FLJ20001 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001178005, the custom clone sequence may differ by one or more nucleotides
ATGGCACCTGCTGGACGCCCGGGGGCCAAGAAGGGGATTTTGGAGCGCCTGGAGAGTGGGGAGGTTGTGA TTGGAGATGGCAGCTTTCTCATTACTCTGGAGAAGAGAGGCTATGTGAAGGCTGGGCTCTGGACTCCAGA GGCAGTGATAGAACACCCAGACGCAGTTCGTCAACTTCACATGGAATTCTTGAGAGCAGGATCAAATGTC ATGCAGACTTTTACCTTTTCTGCCAGTGAGGACAATATGGAAAGCAAGTATTTTGAGCACGTTGAAGAAG CTGTGTGGGCTGTGGAAGTCTTAAAAGAATCAGATAGACCCGTGGCAGTTACCATGTGCATAGGCCCAGA GGGAGACATGCATGATATAACCCCCGGAGAATGTGCTGTGAGGCTGGTGAAGGCAGGGGCTTCCATCGTT GGCGTGAACTGCCGCTTTGGGCCCGACACCAGCTTGAAGACGATGGAGCTCATGAAGGAGGGTCTTGAGT GGGCAGGGCTGAAAGCGCACCTCATGGTGCAGCCTCTGGGGTTCCACGCGCCTGACTGTGGCAAAGAGGG GTTTGTGGATCTCCCAGAATATCCCTTTGGACTGGAGTCCAGAGTTGCCACCAGATGGGATATTCAAAAA TACGCCAGAGAGGCCTACAACCTGGGGGTCAGGTACATTGGCGGGTGCTGTGGATTTGAGCCCTACCACA TCAGGGCAATTGCAGAGGAGCTGGCCCCAGAAAGGGGCTTTTTGCCACCAGCTTCAGAAAAACACGGCAG CTGGGGAAGTGGTTTGGACATGCACACCAAACCCTGGATTAGAGCAAGGGCTCGAAGGGAGTATTGGGAG AATCTGCTGCCAGCTTCAGGCAGACCTTTCTGTCCTTCGCTGTCAAAGCCAGACTTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001178005 |
ORF Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001178005.1, NP_001171476.1 |
RefSeq Size | 2459 |
RefSeq ORF | 900 |
Locus ID | 23743 |
Gene Summary | Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010] Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229850 | BHMT2 (Myc-DDK-tagged)-Human betaine--homocysteine S-methyltransferase 2 (BHMT2), transcript variant 2 |
USD 420.00 |
|
RG229850 | BHMT2 (GFP-tagged) - Human betaine--homocysteine S-methyltransferase 2 (BHMT2), transcript variant 2 |
USD 460.00 |
|
RC229850L3 | Lenti ORF clone of Human betaine--homocysteine S-methyltransferase 2 (BHMT2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229850L4 | Lenti ORF clone of Human betaine--homocysteine S-methyltransferase 2 (BHMT2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review